Incidental Mutation 'R5441:Nlrp4a'
ID427175
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 043006-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26454153 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 710 (L710M)
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably damaging
Transcript: ENSMUST00000068767
AA Change: L710M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: L710M

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119386
AA Change: L710M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: L710M

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect probably damaging
Transcript: ENSMUST00000146907
AA Change: L710M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 intron probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCAAAGATAACAGCTCAGGC -3'
(R):5'- GGGGCACTTATACAGGTCAG -3'

Sequencing Primer
(F):5'- CTGGGTGGAAACCAATGGATACC -3'
(R):5'- CAGAATCCTGACCTGTATAAGTGTG -3'
Posted On2016-09-01