Incidental Mutation 'R5441:Napsa'
ID427178
Institutional Source Beutler Lab
Gene Symbol Napsa
Ensembl Gene ENSMUSG00000002204
Gene Namenapsin A aspartic peptidase
SynonymsKdap, NAP1, napsin, pronapsin
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44572380-44586862 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 44581393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000208514]
Predicted Effect probably benign
Transcript: ENSMUST00000002274
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148180
AA Change: T74S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207543
Predicted Effect probably benign
Transcript: ENSMUST00000208514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Napsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Napsa APN 7 44581421 missense probably benign 0.00
IGL01380:Napsa APN 7 44586674 missense probably damaging 0.99
IGL01521:Napsa APN 7 44586637 missense probably damaging 1.00
IGL01630:Napsa APN 7 44586665 missense probably damaging 1.00
IGL01862:Napsa APN 7 44582493 missense probably damaging 0.99
IGL01935:Napsa APN 7 44586622 missense probably benign 0.01
IGL02421:Napsa APN 7 44585055 missense probably damaging 1.00
IGL02831:Napsa APN 7 44586760 missense probably benign
IGL03008:Napsa APN 7 44585796 missense possibly damaging 0.77
PIT4131001:Napsa UTSW 7 44581451 missense probably damaging 1.00
R0422:Napsa UTSW 7 44585106 missense probably damaging 1.00
R1542:Napsa UTSW 7 44581689 missense probably damaging 1.00
R1564:Napsa UTSW 7 44586649 missense probably damaging 1.00
R1903:Napsa UTSW 7 44581736 missense probably damaging 1.00
R1964:Napsa UTSW 7 44581685 missense probably benign 0.01
R2366:Napsa UTSW 7 44582485 missense probably damaging 1.00
R3713:Napsa UTSW 7 44581428 missense probably damaging 1.00
R5512:Napsa UTSW 7 44572616 start codon destroyed probably null 0.01
R5682:Napsa UTSW 7 44585344 missense possibly damaging 0.92
R6290:Napsa UTSW 7 44581337 missense probably benign 0.00
R7046:Napsa UTSW 7 44585085 missense probably damaging 1.00
R7134:Napsa UTSW 7 44585735 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTCAACGAATCCACCTTGG -3'
(R):5'- GCATGAAGTCAAGTCCCTCGTC -3'

Sequencing Primer
(F):5'- TTGGACACAGAATCTTAAACCCACTG -3'
(R):5'- ATGAAGTCAAGTCCCTCGTCTTCTC -3'
Posted On2016-09-01