Incidental Mutation 'R5441:Atmin'
ID427183
Institutional Source Beutler Lab
Gene Symbol Atmin
Ensembl Gene ENSMUSG00000047388
Gene NameATM interactor
Synonymsgpg6, Asciz
MMRRC Submission 043006-MU
Accession Numbers

Ncbi RefSeq: NM_177700.4; MGI:2682328

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location116943393-116960445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116957957 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 785 (D785E)
Ref Sequence ENSEMBL: ENSMUSP00000104727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109099]
Predicted Effect probably damaging
Transcript: ENSMUST00000109099
AA Change: D785E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104727
Gene: ENSMUSG00000047388
AA Change: D785E

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
ZnF_C2H2 80 105 2.49e-1 SMART
ZnF_C2H2 127 156 7.11e0 SMART
ZnF_C2H2 161 181 4.5e1 SMART
ZnF_C2H2 187 210 1.06e2 SMART
low complexity region 289 304 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 4868762; 4881337
Lethality: E16-E19
PHENOTYPE: Mice homozygous for a knock-out allele exhibit fetal lethality, craniofacial defects, midbrain exencephaly, and premature senescence of mouse embryonic fibroblasts. Homozygotes for an ENU-induced mutation exhibit left-right patterning defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Atmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Atmin APN 8 116956657 missense probably damaging 1.00
IGL02680:Atmin APN 8 116957497 missense probably damaging 1.00
IGL03355:Atmin APN 8 116957425 nonsense probably null
K3955:Atmin UTSW 8 116957036 nonsense probably null
P0038:Atmin UTSW 8 116957036 nonsense probably null
R1440:Atmin UTSW 8 116957376 missense probably damaging 0.98
R1498:Atmin UTSW 8 116954801 missense probably benign 0.21
R1515:Atmin UTSW 8 116954840 missense possibly damaging 0.87
R2094:Atmin UTSW 8 116957538 missense probably damaging 1.00
R2306:Atmin UTSW 8 116957650 missense probably benign 0.04
R2363:Atmin UTSW 8 116954914 critical splice donor site probably null
R2866:Atmin UTSW 8 116956373 missense probably benign
R3743:Atmin UTSW 8 116956573 missense probably benign 0.02
R3901:Atmin UTSW 8 116956297 missense probably benign 0.00
R3902:Atmin UTSW 8 116956297 missense probably benign 0.00
R4664:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4665:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4666:Atmin UTSW 8 116957959 missense probably damaging 1.00
R5496:Atmin UTSW 8 116957172 missense probably benign 0.01
R6914:Atmin UTSW 8 116956713 missense probably benign 0.02
R6942:Atmin UTSW 8 116956713 missense probably benign 0.02
R6965:Atmin UTSW 8 116957038 missense probably damaging 1.00
R7172:Atmin UTSW 8 116956542 missense probably damaging 1.00
V7732:Atmin UTSW 8 116956479 missense probably damaging 1.00
X0020:Atmin UTSW 8 116952982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACACTCCAGCTTCTCC -3'
(R):5'- TCTAAACAGCTGCCCCACTG -3'

Sequencing Primer
(F):5'- AGCTTCTCCATGAGTACCGAC -3'
(R):5'- TGACTACATCCCCAGTCGGTG -3'
Posted On2016-09-01