Incidental Mutation 'R5441:Msi2'
ID427191
Institutional Source Beutler Lab
Gene Symbol Msi2
Ensembl Gene ENSMUSG00000069769
Gene Namemusashi RNA-binding protein 2
Synonymsmsi2h, Musashi2
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5441 (G1)
Quality Score127
Status Validated
Chromosome11
Chromosomal Location88339382-88718513 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 88718095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092794] [ENSMUST00000107908] [ENSMUST00000107909] [ENSMUST00000144699]
Predicted Effect probably benign
Transcript: ENSMUST00000092794
SMART Domains Protein: ENSMUSP00000090470
Gene: ENSMUSG00000069769

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
low complexity region 275 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107908
SMART Domains Protein: ENSMUSP00000103541
Gene: ENSMUSG00000069769

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107909
SMART Domains Protein: ENSMUSP00000103542
Gene: ENSMUSG00000069769

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138790
Predicted Effect probably benign
Transcript: ENSMUST00000144699
SMART Domains Protein: ENSMUSP00000119684
Gene: ENSMUSG00000069769

DomainStartEndE-ValueType
RRM 1 72 8.31e-21 SMART
internal_repeat_1 90 113 1.41e-5 PROSPERO
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality, decreased body size, and decreased hematopoietic stem cells. Mice homozygous for a conditional knock-out allele exhibit impaired hematopoietic stem cell physiology upon induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Msi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mikimoto UTSW 11 88366784 critical splice donor site probably null
mixmaster UTSW 11 88716580 missense probably damaging 1.00
miyamoto UTSW 11 88716580 missense probably damaging 1.00
P0027:Msi2 UTSW 11 88394597 missense probably damaging 1.00
R1366:Msi2 UTSW 11 88716580 missense probably damaging 1.00
R2208:Msi2 UTSW 11 88590108 missense probably damaging 1.00
R2414:Msi2 UTSW 11 88716547 missense probably damaging 1.00
R4151:Msi2 UTSW 11 88718044 missense probably damaging 1.00
R4166:Msi2 UTSW 11 88347088 missense probably benign 0.29
R4494:Msi2 UTSW 11 88717359 missense possibly damaging 0.91
R4647:Msi2 UTSW 11 88718038 missense possibly damaging 0.83
R4952:Msi2 UTSW 11 88366784 critical splice donor site probably null
R4975:Msi2 UTSW 11 88394655 missense probably damaging 1.00
R5441:Msi2 UTSW 11 88479992 splice site probably benign
R5715:Msi2 UTSW 11 88386063 missense probably damaging 1.00
R5768:Msi2 UTSW 11 88717738 missense probably damaging 1.00
R7297:Msi2 UTSW 11 88480038 missense probably damaging 0.97
T0722:Msi2 UTSW 11 88394597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCGGCCATTTTGACGTG -3'
(R):5'- CACGACGTTCTAGAACTCCG -3'

Sequencing Primer
(F):5'- GGCCATTTTGACGTGTAACTTAC -3'
(R):5'- GTTCTAGAACTCCGCCCCACG -3'
Posted On2016-09-01