Incidental Mutation 'R5441:Ropn1'
ID427203
Institutional Source Beutler Lab
Gene Symbol Ropn1
Ensembl Gene ENSMUSG00000022832
Gene Nameropporin, rhophilin associated protein 1
SynonymsRHPNAP1, ropporin, ODF6, 1700008N21Rik
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34649921-34678618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34666797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 34 (I34M)
Ref Sequence ENSEMBL: ENSMUSP00000122122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023530] [ENSMUST00000148562]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023530
AA Change: I34M

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023530
Gene: ENSMUSG00000022832
AA Change: I34M

DomainStartEndE-ValueType
PDB:2KYG|B 6 41 3e-6 PDB
SCOP:d1r2aa_ 10 44 5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148562
AA Change: I34M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122122
Gene: ENSMUSG00000022832
AA Change: I34M

DomainStartEndE-ValueType
Pfam:RIIa 12 43 2.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231612
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the fibrous sheath of spermatazoa, where it interacts with rhophilin, a Rho GTPase binding protein. The encoded protein also can bind an A-kinase anchoring protein (AKAP110) and a calcium-binding tyrosine phosphorylation-regulated protein (CABYR). This protein may be involved in sperm motility and has been shown to be a cancer-testis antigen in hematologic malignancies. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced sperm motility and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Ropn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Ropn1 APN 16 34678420 missense probably damaging 1.00
IGL01487:Ropn1 APN 16 34678469 missense probably damaging 1.00
IGL01610:Ropn1 APN 16 34666771 missense probably damaging 1.00
IGL01634:Ropn1 APN 16 34666771 missense probably damaging 1.00
IGL01634:Ropn1 APN 16 34666778 missense possibly damaging 0.95
IGL02125:Ropn1 APN 16 34666777 missense probably benign 0.32
IGL02312:Ropn1 APN 16 34677277 missense probably benign 0.01
R0411:Ropn1 UTSW 16 34669964 missense probably benign 0.19
R4249:Ropn1 UTSW 16 34678456 nonsense probably null
R4680:Ropn1 UTSW 16 34677305 missense possibly damaging 0.56
R5078:Ropn1 UTSW 16 34666791 missense probably damaging 1.00
R5440:Ropn1 UTSW 16 34671172 missense probably benign 0.00
R6895:Ropn1 UTSW 16 34677298 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CGTTTCATGATTGCTTAGGACTC -3'
(R):5'- ATTTGCCCCAGGACACTTG -3'

Sequencing Primer
(F):5'- GACTCAAATAAAATCCTCGCGTTCTG -3'
(R):5'- ACTCAATCTGGCTAGTTTAGGGAAG -3'
Posted On2016-09-01