Incidental Mutation 'R5441:Olfr103'
ID427206
Institutional Source Beutler Lab
Gene Symbol Olfr103
Ensembl Gene ENSMUSG00000049618
Gene Nameolfactory receptor 103
SynonymsMOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37334303-37339698 bp(-) (GRCm38)
Type of Mutationunclassified (21 bp from exon)
DNA Base Change (assembly) T to C at 37336268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058826] [ENSMUST00000173472] [ENSMUST00000173472]
Predicted Effect probably null
Transcript: ENSMUST00000058826
SMART Domains Protein: ENSMUSP00000094934
Gene: ENSMUSG00000049618

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 3.5e-52 PFAM
Pfam:7tm_1 39 289 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173472
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173472
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Olfr103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Olfr103 APN 17 37336583 nonsense probably null
IGL01953:Olfr103 APN 17 37336875 missense probably damaging 1.00
IGL02556:Olfr103 APN 17 37336996 missense probably benign 0.00
IGL02574:Olfr103 APN 17 37336524 missense probably damaging 1.00
IGL02737:Olfr103 APN 17 37336773 missense possibly damaging 0.94
IGL02995:Olfr103 APN 17 37336709 missense probably damaging 1.00
R1078:Olfr103 UTSW 17 37337026 missense probably damaging 0.98
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R3024:Olfr103 UTSW 17 37337027 missense probably damaging 1.00
R3858:Olfr103 UTSW 17 37337226 nonsense probably null
R4979:Olfr103 UTSW 17 37336868 missense probably benign 0.06
R5062:Olfr103 UTSW 17 37336931 missense probably damaging 0.99
R5215:Olfr103 UTSW 17 37336813 missense probably benign 0.00
R5453:Olfr103 UTSW 17 37337062 missense possibly damaging 0.96
R5525:Olfr103 UTSW 17 37336626 missense probably damaging 0.99
R5660:Olfr103 UTSW 17 37336644 missense probably damaging 1.00
R5859:Olfr103 UTSW 17 37336369 missense possibly damaging 0.61
R6211:Olfr103 UTSW 17 37336708 missense possibly damaging 0.90
R6958:Olfr103 UTSW 17 37336417 missense probably benign
R7060:Olfr103 UTSW 17 37336461 missense probably benign 0.02
Z1088:Olfr103 UTSW 17 37336705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCCTAAGTCCATGTTATCAAC -3'
(R):5'- CTCAGGCAGCTCTTTAGACCAG -3'

Sequencing Primer
(F):5'- TATGTCCAAAACAAATTCAGGGAC -3'
(R):5'- GCAGCTCTTTAGACCAGGACAG -3'
Posted On2016-09-01