Incidental Mutation 'R5442:Adcy10'
ID427209
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165513140 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 238 (D238G)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: D238G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: D238G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: D238G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: D238G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: D238G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: D238G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: D238G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: D238G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGTGTCCTGTACTAGAC -3'
(R):5'- TTAGTGTTTGGAAGCAGACAGATG -3'

Sequencing Primer
(F):5'- CCTGTACTAGACATACTGTTTGCAGG -3'
(R):5'- ACCCGGCATTGTTCTGAAGAATG -3'
Posted On2016-09-01