Incidental Mutation 'R5442:Gal3st4'
ID427222
Institutional Source Beutler Lab
Gene Symbol Gal3st4
Ensembl Gene ENSMUSG00000075593
Gene Namegalactose-3-O-sulfotransferase 4
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138264921-138272840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138265780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000124841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably benign
Transcript: ENSMUST00000048421
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100530
AA Change: V319A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593
AA Change: V319A

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably benign
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect possibly damaging
Transcript: ENSMUST00000161279
AA Change: V319A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593
AA Change: V319A

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161647
AA Change: V314A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593
AA Change: V314A

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate to the C-3' position of galactose residues in O-linked glycoproteins. This enzyme is highly specific for core 1 structures, with asialofetuin, Gal-beta-1,3-GalNAc and Gal-beta-1,3 (GlcNAc-beta-1,6)GalNAc being good substrates. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Gal3st4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gal3st4 APN 5 138271402 start codon destroyed probably null 0.99
IGL01916:Gal3st4 APN 5 138270935 missense probably damaging 1.00
IGL02724:Gal3st4 APN 5 138265417 missense probably benign 0.30
IGL02978:Gal3st4 APN 5 138265669 missense probably damaging 1.00
R0506:Gal3st4 UTSW 5 138265889 missense probably benign 0.19
R1858:Gal3st4 UTSW 5 138270788 unclassified probably null
R1914:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R1915:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R4615:Gal3st4 UTSW 5 138266263 missense probably damaging 0.97
R4805:Gal3st4 UTSW 5 138265471 unclassified probably null
R5334:Gal3st4 UTSW 5 138265721 missense probably benign 0.01
R6913:Gal3st4 UTSW 5 138270828 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCCATACTGTTCTATCCGCG -3'
(R):5'- ACATATTGTACCTTCCGGTGCTAG -3'

Sequencing Primer
(F):5'- GCCCACAGACTACGGTTGAAG -3'
(R):5'- GCTGCTGATAGTTACAAGCAGCC -3'
Posted On2016-09-01