Incidental Mutation 'R5443:Fat4'
ID427262
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene NameFAT atypical cadherin 4
Synonyms6030410K14Rik
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location38886940-39011985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39010370 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 4825 (L4825P)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: L4825P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: L4825P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196190
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38889004 missense probably benign 0.04
PIT4696001:Fat4 UTSW 3 38982357 missense probably damaging 0.98
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2152:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R4973:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5384:Fat4 UTSW 3 38995946 missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38887245 missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6590:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
R7017:Fat4 UTSW 3 38891543 missense probably benign
R7030:Fat4 UTSW 3 38981958 missense probably damaging 1.00
R7044:Fat4 UTSW 3 39010810 missense probably benign
R7044:Fat4 UTSW 3 39010811 missense probably benign 0.02
R7045:Fat4 UTSW 3 38888601 missense probably benign 0.01
R7094:Fat4 UTSW 3 38889874 missense probably damaging 1.00
R7111:Fat4 UTSW 3 39010533 missense probably damaging 1.00
R7130:Fat4 UTSW 3 38980787 missense probably damaging 0.99
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCATGGATCGAGACCAGG -3'
(R):5'- TGCGTCCATGGTACCTTCTG -3'

Sequencing Primer
(F):5'- CAGGGAGTCGCCTCAAACAG -3'
(R):5'- GGTTTCAGTCTGGCTCCATAATTATC -3'
Posted On2016-09-01