Incidental Mutation 'R5444:Ncstn'
ID427315
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Namenicastrin
SynonymsNct, nicastrin, D1Dau13e, 9430068N19Rik
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5444 (G1)
Quality Score212
Status Validated
Chromosome1
Chromosomal Location172066013-172082795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 172072839 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 223 (V223G)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003550
AA Change: V223G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V223G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 172074401 missense probably benign 0.02
IGL02030:Ncstn APN 1 172072457 splice site probably benign
IGL02470:Ncstn APN 1 172082599 critical splice donor site probably null
IGL02498:Ncstn APN 1 172068592 missense probably benign
pig UTSW 1 172071525 missense probably damaging 1.00
truffle UTSW 1 172070009 missense probably damaging 1.00
R0048:Ncstn UTSW 1 172069961 splice site probably benign
R0480:Ncstn UTSW 1 172082592 splice site probably benign
R0648:Ncstn UTSW 1 172067887 missense probably benign 0.01
R0792:Ncstn UTSW 1 172071505 missense possibly damaging 0.95
R1330:Ncstn UTSW 1 172071525 missense probably damaging 1.00
R1524:Ncstn UTSW 1 172072149 missense possibly damaging 0.58
R1660:Ncstn UTSW 1 172066772 missense possibly damaging 0.78
R1828:Ncstn UTSW 1 172071471 frame shift probably null
R1892:Ncstn UTSW 1 172071471 frame shift probably null
R1907:Ncstn UTSW 1 172072143 missense probably damaging 0.97
R3722:Ncstn UTSW 1 172067895 missense possibly damaging 0.50
R3876:Ncstn UTSW 1 172070073 missense probably benign 0.02
R3946:Ncstn UTSW 1 172067494 missense probably benign 0.00
R3969:Ncstn UTSW 1 172070009 missense probably damaging 1.00
R4108:Ncstn UTSW 1 172072544 missense probably damaging 1.00
R4597:Ncstn UTSW 1 172068256 nonsense probably null
R4998:Ncstn UTSW 1 172071520 missense possibly damaging 0.81
R5037:Ncstn UTSW 1 172068626 missense probably damaging 1.00
R5150:Ncstn UTSW 1 172067584 intron probably benign
R5406:Ncstn UTSW 1 172072164 missense probably benign 0.00
R5605:Ncstn UTSW 1 172081150 intron probably benign
R6675:Ncstn UTSW 1 172071528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTTATGGAGAAGGCCTTCAAG -3'
(R):5'- GCTTAAGAATGGAGCTGGGC -3'

Sequencing Primer
(F):5'- TATGGAGAAGGCCTTCAAGATACCTC -3'
(R):5'- TAAGAATGGAGCTGGGCCTTCC -3'
Posted On2016-09-01