Incidental Mutation 'R5444:Nnat'
ID427317
Institutional Source Beutler Lab
Gene Symbol Nnat
Ensembl Gene ENSMUSG00000067786
Gene Nameneuronatin
SynonymsPeg5, 5730414I02Rik
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157560078-157562522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157561217 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 26 (F26S)
Ref Sequence ENSEMBL: ENSMUSP00000105152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088484] [ENSMUST00000088494] [ENSMUST00000109526] [ENSMUST00000109528] [ENSMUST00000153739] [ENSMUST00000172487] [ENSMUST00000173041] [ENSMUST00000173378] [ENSMUST00000173595] [ENSMUST00000173793] [ENSMUST00000173839]
Predicted Effect probably benign
Transcript: ENSMUST00000088484
SMART Domains Protein: ENSMUSP00000085836
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
low complexity region 71 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088494
SMART Domains Protein: ENSMUSP00000085849
Gene: ENSMUSG00000067787

DomainStartEndE-ValueType
Pfam:BC10 1 65 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104797
Predicted Effect possibly damaging
Transcript: ENSMUST00000109526
AA Change: F26S

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105152
Gene: ENSMUSG00000067786
AA Change: F26S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109528
SMART Domains Protein: ENSMUSP00000105154
Gene: ENSMUSG00000067787

DomainStartEndE-ValueType
Pfam:BC10 1 65 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152605
Predicted Effect probably benign
Transcript: ENSMUST00000153739
SMART Domains Protein: ENSMUSP00000129821
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172487
SMART Domains Protein: ENSMUSP00000134415
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000173041
SMART Domains Protein: ENSMUSP00000134109
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173378
Predicted Effect probably benign
Transcript: ENSMUST00000173595
AA Change: F26S

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133397
Gene: ENSMUSG00000067786
AA Change: F26S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 67 76 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000173793
SMART Domains Protein: ENSMUSP00000133487
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173839
AA Change: F26S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133394
Gene: ENSMUSG00000067786
AA Change: F26S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a proteolipid that may be involved in the regulation of ion channels during brain development. The encoded protein may also play a role in forming and maintaining the structure of the nervous system. This gene is found within an intron of another gene, bladder cancer associated protein, but on the opposite strand. This gene is imprinted and is expressed only from the paternal allele. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted mutation do not exhibit a detected mutant phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Nnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Nnat APN 2 157561247 missense possibly damaging 0.59
R0045:Nnat UTSW 2 157560488 intron probably benign
R4885:Nnat UTSW 2 157561758 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCGAATTGGAAACACACTAGAG -3'
(R):5'- ACAGCTTGTCCACCAGTCAG -3'

Sequencing Primer
(F):5'- CCTTGCAGGACAAAAACGG -3'
(R):5'- TTGTCCACCAGTCAGGGCAG -3'
Posted On2016-09-01