Incidental Mutation 'R5444:Dhdds'
ID427324
Institutional Source Beutler Lab
Gene Symbol Dhdds
Ensembl Gene ENSMUSG00000012117
Gene Namedehydrodolichyl diphosphate synthase
Synonyms
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133969028-134000918 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 133971136 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 295 (R295*)
Ref Sequence ENSEMBL: ENSMUSP00000116098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012262] [ENSMUST00000100472] [ENSMUST00000102552] [ENSMUST00000102553] [ENSMUST00000105885] [ENSMUST00000105886] [ENSMUST00000105887] [ENSMUST00000105889] [ENSMUST00000105893] [ENSMUST00000130464] [ENSMUST00000136327] [ENSMUST00000144668]
Predicted Effect probably null
Transcript: ENSMUST00000012262
AA Change: R295*
SMART Domains Protein: ENSMUSP00000012262
Gene: ENSMUSG00000012117
AA Change: R295*

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100472
SMART Domains Protein: ENSMUSP00000098040
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 2 88 1.67e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102552
SMART Domains Protein: ENSMUSP00000099612
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 2 86 4.6e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102553
SMART Domains Protein: ENSMUSP00000099613
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 2 86 4.6e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105885
AA Change: R261*
SMART Domains Protein: ENSMUSP00000101509
Gene: ENSMUSG00000012117
AA Change: R261*

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 149 5.2e-42 PFAM
Pfam:Prenyltransf 145 222 1.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105886
AA Change: R256*
SMART Domains Protein: ENSMUSP00000101510
Gene: ENSMUSG00000012117
AA Change: R256*

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 109 9.8e-32 PFAM
Pfam:Prenyltransf 104 217 6.2e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105887
AA Change: R296*
SMART Domains Protein: ENSMUSP00000101511
Gene: ENSMUSG00000012117
AA Change: R296*

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 255 6.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105889
SMART Domains Protein: ENSMUSP00000101512
Gene: ENSMUSG00000012117

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 5.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105893
SMART Domains Protein: ENSMUSP00000101513
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 12 92 1.13e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123234
SMART Domains Protein: ENSMUSP00000120795
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 28 108 1.13e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125266
Predicted Effect probably null
Transcript: ENSMUST00000130464
AA Change: R130*
SMART Domains Protein: ENSMUSP00000121656
Gene: ENSMUSG00000012117
AA Change: R130*

DomainStartEndE-ValueType
Pfam:Prenyltransf 1 54 1.8e-8 PFAM
Pfam:Prenyltransf 50 99 2.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134096
Predicted Effect probably benign
Transcript: ENSMUST00000136327
SMART Domains Protein: ENSMUSP00000114704
Gene: ENSMUSG00000003038

DomainStartEndE-ValueType
HMG17 2 86 1.99e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142660
Predicted Effect probably null
Transcript: ENSMUST00000144668
AA Change: R295*
SMART Domains Protein: ENSMUSP00000116098
Gene: ENSMUSG00000012117
AA Change: R295*

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153622
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Dhdds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Dhdds APN 4 134000260 splice site probably benign
IGL01566:Dhdds APN 4 133991337 missense probably damaging 0.99
IGL03024:Dhdds APN 4 133982849 missense probably damaging 1.00
IGL03115:Dhdds APN 4 133982871 missense probably benign
LCD18:Dhdds UTSW 4 133970363 utr 3 prime probably benign
R0622:Dhdds UTSW 4 133994236 missense probably damaging 1.00
R2036:Dhdds UTSW 4 133971099 missense probably damaging 1.00
R5284:Dhdds UTSW 4 133980212 missense probably benign 0.06
R5780:Dhdds UTSW 4 133996830 missense probably damaging 1.00
R5781:Dhdds UTSW 4 133996830 missense probably damaging 1.00
R6723:Dhdds UTSW 4 133994265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGGGAGCCCAATTC -3'
(R):5'- GTACTTGGCCATTCTGTGCC -3'

Sequencing Primer
(F):5'- CAAAAACAGGGAAGTGCCTTTTC -3'
(R):5'- GGCCATTCTGTGCCCTATC -3'
Posted On2016-09-01