Incidental Mutation 'R5444:BC037034'
ID427330
Institutional Source Beutler Lab
Gene Symbol BC037034
Ensembl Gene ENSMUSG00000036948
Gene NamecDNA sequence BC037034
Synonyms
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138259656-138264033 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 138260998 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000062067] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably null
Transcript: ENSMUST00000048421
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062067
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably null
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160157
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161604
SMART Domains Protein: ENSMUSP00000125441
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Predicted Effect probably null
Transcript: ENSMUST00000163268
SMART Domains Protein: ENSMUSP00000127072
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164203
SMART Domains Protein: ENSMUSP00000127440
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Pfam:DUF4707 139 579 4.7e-252 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167840
SMART Domains Protein: ENSMUSP00000132756
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170479
AA Change: L825Q
Predicted Effect probably null
Transcript: ENSMUST00000171557
SMART Domains Protein: ENSMUSP00000128031
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in BC037034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:BC037034 APN 5 138261705 missense possibly damaging 0.46
IGL01617:BC037034 APN 5 138262216 missense probably damaging 1.00
IGL02256:BC037034 APN 5 138260315 missense probably damaging 0.99
IGL02493:BC037034 APN 5 138263170 unclassified probably null
IGL02904:BC037034 APN 5 138260602 missense probably benign 0.04
IGL03151:BC037034 APN 5 138262672 missense possibly damaging 0.95
R0005:BC037034 UTSW 5 138262654 splice site probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0619:BC037034 UTSW 5 138263826 unclassified probably benign
R0630:BC037034 UTSW 5 138262289 missense probably damaging 0.98
R1579:BC037034 UTSW 5 138261866 missense probably benign 0.00
R1778:BC037034 UTSW 5 138262477 unclassified probably null
R1816:BC037034 UTSW 5 138260341 missense possibly damaging 0.91
R2009:BC037034 UTSW 5 138260929 missense probably damaging 1.00
R4711:BC037034 UTSW 5 138262905 unclassified probably benign
R4923:BC037034 UTSW 5 138262379 unclassified probably benign
R4999:BC037034 UTSW 5 138261622 missense probably damaging 1.00
R5103:BC037034 UTSW 5 138262300 missense probably benign 0.15
R5221:BC037034 UTSW 5 138262240 missense probably benign 0.14
R5720:BC037034 UTSW 5 138263702 missense probably benign 0.00
R6519:BC037034 UTSW 5 138261848 missense probably damaging 0.99
R6599:BC037034 UTSW 5 138263458 unclassified probably null
R6918:BC037034 UTSW 5 138260664 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTAGCTAACCCCTCTAGAAGC -3'
(R):5'- TGGGTTAGCACAGACCACAG -3'

Sequencing Primer
(F):5'- TCGACTATTCTACCCAACACTGG -3'
(R):5'- GCACCCAGCATTAACCGTTG -3'
Posted On2016-09-01