Incidental Mutation 'R5444:Tuba8'
ID427334
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Nametubulin, alpha 8
Synonyms
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121210696-121226854 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 121226101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
Predicted Effect probably benign
Transcript: ENSMUST00000032233
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124853
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121220511 missense probably benign
IGL02725:Tuba8 APN 6 121225957 nonsense probably null
IGL03091:Tuba8 APN 6 121220444 missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121222954 missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121225904 missense probably benign 0.37
R1424:Tuba8 UTSW 6 121220511 missense probably benign
R1624:Tuba8 UTSW 6 121220426 missense probably damaging 1.00
R1741:Tuba8 UTSW 6 121222768 missense possibly damaging 0.95
R1985:Tuba8 UTSW 6 121220520 missense probably benign 0.00
R2513:Tuba8 UTSW 6 121225973 missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R4074:Tuba8 UTSW 6 121222797 missense probably damaging 1.00
R4875:Tuba8 UTSW 6 121226083 utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121220589 missense probably damaging 1.00
R5073:Tuba8 UTSW 6 121222903 missense probably damaging 0.99
R5546:Tuba8 UTSW 6 121222913 nonsense probably null
R5594:Tuba8 UTSW 6 121225904 missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121225895 missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121222912 missense probably damaging 1.00
R7489:Tuba8 UTSW 6 121226021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGACCTCATGTACGCC -3'
(R):5'- CCGTCTATGTAGGACAGGAAGTAG -3'

Sequencing Primer
(F):5'- CCAAGCGGGCCTTTGTACATTG -3'
(R):5'- TCTATGTAGGACAGGAAGTAGGCTGG -3'
Posted On2016-09-01