Incidental Mutation 'R5444:Chd2'
ID427340
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 043009-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73473085 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 967 (E967G)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
Predicted Effect probably damaging
Transcript: ENSMUST00000169922
AA Change: E967G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E967G

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198225
Predicted Effect probably benign
Transcript: ENSMUST00000199809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199831
Predicted Effect probably benign
Transcript: ENSMUST00000200423
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTGGATCATATGCCAGCTCT -3'
(R):5'- GAAGTCCAGGTCCAGAGTGC -3'

Sequencing Primer
(F):5'- GATTACCTGAGGCTCTGA -3'
(R):5'- CTGGTTCCTGCAGATATCACAGGAG -3'
Posted On2016-09-01