Incidental Mutation 'R5444:Olfr399'
ID427350
Institutional Source Beutler Lab
Gene Symbol Olfr399
Ensembl Gene ENSMUSG00000043692
Gene Nameolfactory receptor 399
SynonymsGA_x6K02T2P1NL-4211516-4210581, MOR255-1
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74053127-74056615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74053977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 261 (S261G)
Ref Sequence ENSEMBL: ENSMUSP00000149917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059440] [ENSMUST00000206280] [ENSMUST00000215915]
Predicted Effect probably benign
Transcript: ENSMUST00000059440
AA Change: S261G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056508
Gene: ENSMUSG00000043692
AA Change: S261G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.9e-55 PFAM
Pfam:7tm_1 44 293 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125093
Predicted Effect probably benign
Transcript: ENSMUST00000206280
Predicted Effect probably benign
Transcript: ENSMUST00000215915
AA Change: S261G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Olfr399
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Olfr399 APN 11 74054475 missense probably benign 0.41
R1344:Olfr399 UTSW 11 74054212 nonsense probably null
R1496:Olfr399 UTSW 11 74053824 makesense probably null
R1708:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R1911:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R2056:Olfr399 UTSW 11 74053993 nonsense probably null
R3418:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R5470:Olfr399 UTSW 11 74053907 missense possibly damaging 0.90
R6150:Olfr399 UTSW 11 74054319 missense probably benign 0.03
R6442:Olfr399 UTSW 11 74054679 missense probably benign 0.00
R6687:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R7195:Olfr399 UTSW 11 74054397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGACATTGGTTAAGGCC -3'
(R):5'- ATCCAACTCAATGAGCAGCTG -3'

Sequencing Primer
(F):5'- GCCAAAAGAAAAGAGTGTCATTAGTG -3'
(R):5'- GCTCTTTGTAGCAGCAGCC -3'
Posted On2016-09-01