Incidental Mutation 'R5444:Polr3a'
ID427359
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.983) question?
Stock #R5444 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24454941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATTACCCGCACTGTCATGG -3'
(R):5'- TCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'
Posted On2016-09-01