Incidental Mutation 'R5445:Cep350'
ID427374
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 043010-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155894723 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1807 (D1807G)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000129865
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: D1807G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: D1807G

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTGTCTAGATAATCTAGTAATCTGC -3'
(R):5'- CACACTACTTTTAAGTATGCGATGG -3'

Sequencing Primer
(F):5'- TCTGCCTACCCTGACGACG -3'
(R):5'- AAGTATGCGATGGATTTCTGTTC -3'
Posted On2016-09-01