Incidental Mutation 'R5445:Mia3'
ID427377
Institutional Source Beutler Lab
Gene Symbol Mia3
Ensembl Gene ENSMUSG00000056050
Gene Namemelanoma inhibitory activity 3
Synonyms9130229H14Rik, B230399H06Rik, LOC385255, A930039G15Rik, Tango
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location183326725-183369553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 183336022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000104786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109158]
Predicted Effect probably benign
Transcript: ENSMUST00000069922
SMART Domains Protein: ENSMUSP00000064801
Gene: ENSMUSG00000056050

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 48 106 2.78e-2 SMART
low complexity region 138 147 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 767 774 N/A INTRINSIC
coiled coil region 1240 1329 N/A INTRINSIC
coiled coil region 1362 1427 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
coiled coil region 1517 1565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109158
AA Change: V208A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104786
Gene: ENSMUSG00000056050
AA Change: V208A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
SCOP:d1fxkc_ 159 274 2e-4 SMART
low complexity region 281 294 N/A INTRINSIC
SCOP:d1fxkc_ 365 463 1e-3 SMART
low complexity region 482 498 N/A INTRINSIC
low complexity region 557 567 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 635 661 N/A INTRINSIC
low complexity region 665 680 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195233
AA Change: V115A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for the large isoform display complete perinatal lethality with impaired collagen secretion, intracellular collagen aggregates, short limbed dwarfism, and arrest of chondrocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Mia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1037:Mia3 UTSW 1 183357354 missense probably benign 0.06
R1489:Mia3 UTSW 1 183338674 missense probably benign
R1997:Mia3 UTSW 1 183344286 missense possibly damaging 0.72
R2261:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2263:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2334:Mia3 UTSW 1 183334402 critical splice donor site probably null
R3417:Mia3 UTSW 1 183362100 missense probably damaging 1.00
R3872:Mia3 UTSW 1 183356998 missense probably benign 0.04
R3943:Mia3 UTSW 1 183358783 missense possibly damaging 0.54
R4398:Mia3 UTSW 1 183330878 missense probably damaging 1.00
R4746:Mia3 UTSW 1 183345220 missense possibly damaging 0.80
R4814:Mia3 UTSW 1 183332830 missense probably damaging 0.98
R4975:Mia3 UTSW 1 183331115 missense probably benign 0.02
R5104:Mia3 UTSW 1 183338132 missense probably damaging 0.98
R5174:Mia3 UTSW 1 183331493 nonsense probably null
R5272:Mia3 UTSW 1 183328270 nonsense probably null
R5651:Mia3 UTSW 1 183358654 missense probably damaging 1.00
R5852:Mia3 UTSW 1 183332859 missense probably benign 0.01
R6246:Mia3 UTSW 1 183345277 missense probably damaging 0.99
R6565:Mia3 UTSW 1 183331485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATAGTTCGCTCTTCCC -3'
(R):5'- CTGGTTGAGCAAAAGTTTGAGG -3'

Sequencing Primer
(F):5'- ATAGTTCGCTCTTCCCAGCAC -3'
(R):5'- ACCTGCATGATGTTTGGT -3'
Posted On2016-09-01