Incidental Mutation 'R5445:Usp33'
ID427386
Institutional Source Beutler Lab
Gene Symbol Usp33
Ensembl Gene ENSMUSG00000025437
Gene Nameubiquitin specific peptidase 33
SynonymsVdu1, 9830169D19Rik
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152346478-152393617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152374623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 464 (S464T)
Ref Sequence ENSEMBL: ENSMUSP00000026507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026507] [ENSMUST00000117492] [ENSMUST00000123237] [ENSMUST00000197748]
Predicted Effect probably damaging
Transcript: ENSMUST00000026507
AA Change: S464T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026507
Gene: ENSMUSG00000025437
AA Change: S464T

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 671 2.2e-71 PFAM
Pfam:UCH_1 154 387 1.4e-9 PFAM
Pfam:UCH_1 371 653 6.8e-25 PFAM
DUSP 691 774 4.4e-17 SMART
DUSP 799 883 2.44e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117492
AA Change: S464T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113265
Gene: ENSMUSG00000025437
AA Change: S464T

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 1.6e-64 PFAM
Pfam:UCH_1 154 387 1.2e-8 PFAM
Pfam:UCH_1 366 661 1.3e-23 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123237
SMART Domains Protein: ENSMUSP00000117590
Gene: ENSMUSG00000025437

DomainStartEndE-ValueType
PDB:2UZG|A 5 45 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197600
Predicted Effect probably damaging
Transcript: ENSMUST00000197748
AA Change: S464T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142708
Gene: ENSMUSG00000025437
AA Change: S464T

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 2.3e-71 PFAM
Pfam:UCH_1 154 383 1.2e-9 PFAM
Pfam:UCH_1 368 661 1e-24 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198950
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Usp33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Usp33 APN 3 152373409 missense probably benign 0.00
IGL01085:Usp33 APN 3 152368569 missense possibly damaging 0.89
IGL01335:Usp33 APN 3 152392217 missense probably damaging 0.99
IGL02095:Usp33 APN 3 152381794 missense possibly damaging 0.94
IGL02323:Usp33 APN 3 152370387 missense probably benign
IGL03010:Usp33 APN 3 152368596 missense probably benign 0.04
R0464:Usp33 UTSW 3 152376235 splice site probably benign
R0576:Usp33 UTSW 3 152384119 nonsense probably null
R0583:Usp33 UTSW 3 152368254 missense probably damaging 1.00
R0715:Usp33 UTSW 3 152380574 missense probably damaging 1.00
R1445:Usp33 UTSW 3 152368634 missense probably damaging 0.99
R1507:Usp33 UTSW 3 152374763 missense possibly damaging 0.84
R1600:Usp33 UTSW 3 152379610 missense probably damaging 0.98
R1673:Usp33 UTSW 3 152368282 missense probably damaging 1.00
R1945:Usp33 UTSW 3 152379586 missense probably benign 0.07
R1961:Usp33 UTSW 3 152380628 missense probably damaging 1.00
R1973:Usp33 UTSW 3 152360286 missense possibly damaging 0.64
R2231:Usp33 UTSW 3 152373386 missense probably benign 0.00
R2299:Usp33 UTSW 3 152374621 missense probably damaging 0.99
R3001:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3002:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3923:Usp33 UTSW 3 152374791 critical splice donor site probably null
R4366:Usp33 UTSW 3 152368512 missense probably benign 0.44
R4821:Usp33 UTSW 3 152358673 missense probably benign 0.00
R5256:Usp33 UTSW 3 152391696 nonsense probably null
R5396:Usp33 UTSW 3 152384187 missense possibly damaging 0.77
R5877:Usp33 UTSW 3 152379476 missense possibly damaging 0.91
R5877:Usp33 UTSW 3 152379596 missense probably damaging 1.00
R5884:Usp33 UTSW 3 152368330 missense probably benign
R5913:Usp33 UTSW 3 152380592 missense probably damaging 1.00
R5920:Usp33 UTSW 3 152374683 missense probably damaging 1.00
R6331:Usp33 UTSW 3 152376250 missense probably damaging 1.00
R6516:Usp33 UTSW 3 152373416 missense probably benign 0.01
R6624:Usp33 UTSW 3 152381798 missense probably damaging 1.00
R6679:Usp33 UTSW 3 152368487 missense possibly damaging 0.46
X0025:Usp33 UTSW 3 152366758 missense probably damaging 1.00
X0058:Usp33 UTSW 3 152360346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCTGAGCTGCAGGAG -3'
(R):5'- CTAGTACAGCAGAAGCAGCAGC -3'

Sequencing Primer
(F):5'- ATCTCTGAGCTGCAGGAGTACTAATG -3'
(R):5'- GCAGCAGCATCAACATCAATG -3'
Posted On2016-09-01