Incidental Mutation 'R5445:Abcg5'
ID427431
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84671129 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 300 (D300E)
Ref Sequence ENSEMBL: ENSMUSP00000069495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect probably damaging
Transcript: ENSMUST00000066175
AA Change: D300E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: D300E

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2121:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2124:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2858:Abcg5 UTSW 17 84670220 critical splice donor site probably null
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R4963:Abcg5 UTSW 17 84660141 nonsense probably null
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5348:Abcg5 UTSW 17 84671206 missense possibly damaging 0.92
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAAGAGCCGGTGTCATCC -3'
(R):5'- TGGGACTCAGAGGCATATAACAAC -3'

Sequencing Primer
(F):5'- TGATCCCTAGAAGCCATGTCG -3'
(R):5'- GAGGCATATAACAACACCCATATATG -3'
Posted On2016-09-01