Incidental Mutation 'R5445:Casp7'
List |< first << previous [record 31 of 217] next >> last >|
ID427439
Institutional Source Beutler Lab
Gene Symbol Casp7
Ensembl Gene ENSMUSG00000025076
Gene Namecaspase 7
Synonymscaspase-7, ICE-IAP3, CMH-1, Mch3
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5445 (G1)
Quality Score224
Status Not validated
Chromosome19
Chromosomal Location56397129-56442344 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) A to G at 56433338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026062]
Predicted Effect probably null
Transcript: ENSMUST00000026062
SMART Domains Protein: ENSMUSP00000026062
Gene: ENSMUSG00000025076

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
CASc 59 303 2.2e-135 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation have normal appearance, organ morphology and lymphoid development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Casp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Casp7 APN 19 56436745 missense probably benign 0.00
IGL01338:Casp7 APN 19 56404464 missense probably benign
IGL02831:Casp7 APN 19 56404423 missense probably benign 0.01
IGL02886:Casp7 APN 19 56433343 missense probably damaging 1.00
R1558:Casp7 UTSW 19 56433252 nonsense probably null
R2026:Casp7 UTSW 19 56436398 missense probably damaging 1.00
R5665:Casp7 UTSW 19 56440982 missense probably benign 0.00
R5765:Casp7 UTSW 19 56433883 missense possibly damaging 0.87
R6207:Casp7 UTSW 19 56441020 missense possibly damaging 0.53
R6893:Casp7 UTSW 19 56433309 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACCATCTGTCCACCTTG -3'
(R):5'- AGGCCATTTTATCCCAGCAAC -3'

Sequencing Primer
(F):5'- ACCTTGGGTCTTCAACACGG -3'
(R):5'- GGCAGGCTCCTACAGTACATAG -3'
Posted On2016-09-01