Incidental Mutation 'R5411:Olfr1178'
ID427446
Institutional Source Beutler Lab
Gene Symbol Olfr1178
Ensembl Gene ENSMUSG00000056995
Gene Nameolfactory receptor 1178
SynonymsGA_x6K02T2Q125-49870417-49871388, MOR225-6P
MMRRC Submission 042980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5411 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88387062-88400799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88391261 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 5 (T5A)
Ref Sequence ENSEMBL: ENSMUSP00000150036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075640] [ENSMUST00000214040]
Predicted Effect probably benign
Transcript: ENSMUST00000075640
AA Change: T5A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075066
Gene: ENSMUSG00000056995
AA Change: T5A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-49 PFAM
Pfam:7tm_1 39 285 7.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214040
AA Change: T5A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219086
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Acoxl A T 2: 127,854,901 H23L probably benign Het
Adamtsl1 G A 4: 86,388,413 probably null Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Cacna1s G T 1: 136,105,811 V1275L probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdfy4 T C 14: 32,960,002 N3004S probably damaging Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp335 T A 2: 164,902,245 Q500L probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Olfr1178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr1178 APN 2 88391901 missense possibly damaging 0.79
IGL02261:Olfr1178 APN 2 88391381 missense probably benign 0.05
IGL03023:Olfr1178 APN 2 88391343 missense probably damaging 1.00
IGL03053:Olfr1178 APN 2 88391594 missense probably damaging 1.00
IGL03168:Olfr1178 APN 2 88391594 missense probably damaging 1.00
R0432:Olfr1178 UTSW 2 88392033 missense probably damaging 0.98
R1738:Olfr1178 UTSW 2 88391327 missense probably benign 0.01
R2051:Olfr1178 UTSW 2 88391538 missense possibly damaging 0.49
R2136:Olfr1178 UTSW 2 88391319 missense probably benign 0.24
R3236:Olfr1178 UTSW 2 88391406 missense probably benign 0.01
R4407:Olfr1178 UTSW 2 88392083 missense probably benign 0.37
R4930:Olfr1178 UTSW 2 88391940 missense probably benign 0.12
R4959:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R4973:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R5178:Olfr1178 UTSW 2 88391475 missense possibly damaging 0.50
R6282:Olfr1178 UTSW 2 88391533 nonsense probably null
R7289:Olfr1178 UTSW 2 88391706 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTTTCAAATAGCTGCCTTGG -3'
(R):5'- GGTGTAACACAAATCTGAAAGTGC -3'

Sequencing Primer
(F):5'- TCAAATAGCTGCCTTGGAAATC -3'
(R):5'- CACAAATCTGAAAGTGCAAGGTAAC -3'
Posted On2016-09-01