Incidental Mutation 'R5411:Acoxl'
ID427448
Institutional Source Beutler Lab
Gene Symbol Acoxl
Ensembl Gene ENSMUSG00000027380
Gene Nameacyl-Coenzyme A oxidase-like
Synonyms1200014P05Rik
MMRRC Submission 042980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5411 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127838876-128123873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127854901 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 23 (H23L)
Ref Sequence ENSEMBL: ENSMUSP00000028859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028859]
Predicted Effect probably benign
Transcript: ENSMUST00000028859
AA Change: H23L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380
AA Change: H23L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Adamtsl1 G A 4: 86,388,413 probably null Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Cacna1s G T 1: 136,105,811 V1275L probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1178 A G 2: 88,391,261 T5A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdfy4 T C 14: 32,960,002 N3004S probably damaging Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp335 T A 2: 164,902,245 Q500L probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Acoxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Acoxl APN 2 127978804 missense probably damaging 1.00
IGL01397:Acoxl APN 2 128034891 missense possibly damaging 0.67
IGL02502:Acoxl APN 2 128075884 missense probably damaging 1.00
P4748:Acoxl UTSW 2 128086344 splice site probably benign
R0450:Acoxl UTSW 2 127880503 splice site probably null
R0469:Acoxl UTSW 2 127880503 splice site probably null
R0510:Acoxl UTSW 2 127880503 splice site probably null
R1257:Acoxl UTSW 2 128044366 missense probably benign 0.01
R1703:Acoxl UTSW 2 127978772 missense probably damaging 0.99
R1726:Acoxl UTSW 2 127880446 missense probably damaging 1.00
R1867:Acoxl UTSW 2 127877787 missense probably damaging 1.00
R2103:Acoxl UTSW 2 127972606 missense probably damaging 0.97
R2168:Acoxl UTSW 2 127878781 missense probably damaging 1.00
R2761:Acoxl UTSW 2 127877813 missense probably benign 0.01
R3895:Acoxl UTSW 2 127972525 splice site probably benign
R4370:Acoxl UTSW 2 127878788 missense possibly damaging 0.95
R4571:Acoxl UTSW 2 127877807 missense probably damaging 1.00
R4727:Acoxl UTSW 2 127978738 missense probably damaging 1.00
R4851:Acoxl UTSW 2 128044391 missense possibly damaging 0.62
R4962:Acoxl UTSW 2 128075890 missense probably damaging 0.98
R5248:Acoxl UTSW 2 128075935 critical splice donor site probably null
R5392:Acoxl UTSW 2 128010168 critical splice donor site probably null
R5418:Acoxl UTSW 2 127877802 missense probably benign 0.34
R5507:Acoxl UTSW 2 127884474 missense probably damaging 0.99
R5681:Acoxl UTSW 2 127972639 missense possibly damaging 0.93
R5738:Acoxl UTSW 2 127877766 missense probably benign 0.21
R6325:Acoxl UTSW 2 128123024 missense probably benign 0.02
R6800:Acoxl UTSW 2 128010165 missense probably damaging 1.00
R7027:Acoxl UTSW 2 128010083 missense probably benign
R7098:Acoxl UTSW 2 127854915 nonsense probably null
R7165:Acoxl UTSW 2 128123108 missense probably benign
Z1088:Acoxl UTSW 2 127872195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTCTTTGTCCCAGCTC -3'
(R):5'- CTCACCTGCCATACTGAAGG -3'

Sequencing Primer
(F):5'- TCCAGCCCCATGCACTTGG -3'
(R):5'- ACCTTTTACACAACACTTGACTG -3'
Posted On2016-09-01