Incidental Mutation 'R5411:Zfp335'
ID427454
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 042980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5411 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164902245 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 500 (Q500L)
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: Q500L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: Q500L

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183830
AA Change: Q500L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: Q500L

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C A 9: 53,582,646 V392F probably damaging Het
Ache C T 5: 137,290,064 P11S possibly damaging Het
Ache T A 5: 137,290,430 probably null Het
Acoxl A T 2: 127,854,901 H23L probably benign Het
Adamtsl1 G A 4: 86,388,413 probably null Het
Adar T A 3: 89,739,212 F45I probably benign Het
Adgrf4 A C 17: 42,667,213 L413R probably damaging Het
Atp6v1g3 A T 1: 138,287,889 I96F probably benign Het
Brsk2 T C 7: 142,000,857 M653T probably benign Het
Cacna1s G T 1: 136,105,811 V1275L probably benign Het
Ces3b T C 8: 105,088,632 V5A possibly damaging Het
Chpt1 A T 10: 88,477,107 I281N probably damaging Het
Col10a1 A G 10: 34,394,557 E175G probably damaging Het
Col27a1 T C 4: 63,224,665 S197P probably damaging Het
Csmd1 T A 8: 15,910,471 R3315W probably damaging Het
Ctnna2 T C 6: 77,114,931 E443G probably damaging Het
Dhx9 G T 1: 153,481,223 S93R probably benign Het
Efcab8 A G 2: 153,783,756 H112R probably damaging Het
Eif3d A T 15: 77,959,687 N486K probably damaging Het
Esp8 C T 17: 40,530,018 R57* probably null Het
Eya3 A T 4: 132,689,779 I130F probably damaging Het
Fat2 G T 11: 55,252,226 L4266I probably benign Het
Fras1 T A 5: 96,645,160 D983E probably benign Het
Gcc2 T C 10: 58,270,969 S640P probably damaging Het
Gm13119 T A 4: 144,361,637 M1K probably null Het
Gys2 C T 6: 142,448,421 G464R probably damaging Het
Heatr5a G A 12: 51,888,243 T1659I probably damaging Het
Il17ra A G 6: 120,481,442 D518G probably damaging Het
Kcnk13 A G 12: 100,061,251 Y195C probably damaging Het
Kmt2a T A 9: 44,848,485 H722L probably damaging Het
Luzp1 C A 4: 136,543,342 Q959K possibly damaging Het
Mep1b T A 18: 21,086,249 H153Q probably damaging Het
Mfsd13b A T 7: 121,000,123 I381F probably benign Het
Mvk A G 5: 114,458,973 T334A probably benign Het
Naa30 T C 14: 49,187,551 V320A probably damaging Het
Naip5 C T 13: 100,245,746 G152S possibly damaging Het
Neb A C 2: 52,295,372 S949R probably damaging Het
Nfya A T 17: 48,392,018 I214N possibly damaging Het
Nsf G T 11: 103,882,811 N292K probably damaging Het
Nup133 T C 8: 123,927,206 T505A probably benign Het
Olfr1178 A G 2: 88,391,261 T5A probably benign Het
Olfr1231 A C 2: 89,303,576 S5R probably benign Het
Olfr1413 A T 1: 92,573,824 T218S probably benign Het
Olfr192 T A 16: 59,098,704 H96L unknown Het
P4ha3 A T 7: 100,293,815 R136W probably damaging Het
Parp12 A G 6: 39,090,208 V550A probably damaging Het
Phf11a T C 14: 59,294,938 D16G probably benign Het
Rab3gap2 A G 1: 185,277,145 probably null Het
Sco1 A G 11: 67,063,958 D263G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sfpq T A 4: 127,021,723 S103T unknown Het
Shisa7 G A 7: 4,829,976 R263C probably damaging Het
Ssc4d T A 5: 135,963,400 D144V probably benign Het
Stxbp5l G A 16: 37,129,851 P1044L probably damaging Het
Tgm6 G A 2: 130,145,196 R528Q probably benign Het
Tlr3 A T 8: 45,396,955 H892Q probably benign Het
Tmc2 A G 2: 130,240,115 H406R probably damaging Het
Tmtc1 A T 6: 148,443,899 probably null Het
Ttc19 A G 11: 62,284,151 I139M probably benign Het
Utrn G A 10: 12,649,185 R2185C probably benign Het
Wdfy4 T C 14: 32,960,002 N3004S probably damaging Het
Wdr3 C A 3: 100,142,984 G746W probably damaging Het
Zfp804b A T 5: 6,770,071 D961E probably benign Het
Zkscan16 CTTCAGCTTTCA CTTCA 4: 58,956,745 probably null Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACTCACTGTGAAGAACCC -3'
(R):5'- AGCTCAGCAAGTGCCTTCAC -3'

Sequencing Primer
(F):5'- GCATGTCTACATTCTCTCAGAAGG -3'
(R):5'- AGCAAGTGCCTTCACCCCTTC -3'
Posted On2016-09-01