Incidental Mutation 'R5412:Prdx6'
ID427510
Institutional Source Beutler Lab
Gene Symbol Prdx6
Ensembl Gene ENSMUSG00000026701
Gene Nameperoxiredoxin 6
Synonyms1-cysPrx, Brp-12, NSGP, aiPLA2, CC26, Ltw4, Ltw-4, CP-3, Aop2, Lvtw-4, acidic calcium-independent phospholipase A2, 9430088D19Rik, GPx, 1-Cys Prx
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161240112-161251219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161244290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000071636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051925] [ENSMUST00000071718] [ENSMUST00000192639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051925
AA Change: I78N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050703
Gene: ENSMUSG00000026701
AA Change: I78N

DomainStartEndE-ValueType
Pfam:AhpC-TSA 3 122 1.8e-25 PFAM
Pfam:Redoxin 5 139 4.8e-9 PFAM
Pfam:1-cysPrx_C 142 181 6.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071718
AA Change: I102N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071636
Gene: ENSMUSG00000026701
AA Change: I102N

DomainStartEndE-ValueType
Pfam:Redoxin 6 162 1.3e-11 PFAM
Pfam:AhpC-TSA 7 146 3.4e-30 PFAM
Pfam:1-cysPrx_C 166 205 6.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156678
Predicted Effect probably benign
Transcript: ENSMUST00000192639
AA Change: S50T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142093
Gene: ENSMUSG00000026701
AA Change: S50T

DomainStartEndE-ValueType
PDB:1PRX|B 1 43 6e-16 PDB
SCOP:d1prxa_ 5 39 9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194613
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peroxiredoxin family of peroxidases. The encoded protein is a bifunctional enzyme that has glutathione peroxidase and phospholipase activities. This protein is an antioxidant that reduces peroxidized membrane phospholipids and plays an important role in phospholipid homeostasis based on its ability to generate lysophospholipid substrate for the remodeling pathway of phospholipid synthesis. Mice lacking this gene are sensitive to oxidant stress, have altered lung phospholipid metabolism and susceptible to skin tumorigenesis. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene show no macroscopic or microscopic abnormalities. However, they have an increased susceptibility to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Prdx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0540:Prdx6 UTSW 1 161251103 missense probably damaging 1.00
R1479:Prdx6 UTSW 1 161244263 missense probably damaging 0.99
R3700:Prdx6 UTSW 1 161247288 missense probably damaging 1.00
R4930:Prdx6 UTSW 1 161241693 utr 3 prime probably benign
R5577:Prdx6 UTSW 1 161243685 missense probably damaging 1.00
R6842:Prdx6 UTSW 1 161247370 missense probably damaging 1.00
R7229:Prdx6 UTSW 1 161247297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAAGACTCCTCCTAGTC -3'
(R):5'- ATTGCTTGAGGTGAGGAGTACC -3'

Sequencing Primer
(F):5'- GAAAAGGTTGTTTGACCCCC -3'
(R):5'- GCATCTTATTAAGATCCCTTCGAGG -3'
Posted On2016-09-01