Incidental Mutation 'R5412:Bbs7'
ID427515
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36599373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 300 (D300E)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: D300E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: D300E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
AA Change: D300E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: D300E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: D300E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: D300E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Arid1a T C 4: 133,719,602 probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCTATAGCCCCAGCCATTTTC -3'
(R):5'- TGTCTGCACATGATGAACATACAC -3'

Sequencing Primer
(F):5'- TCCCAACACGGTATCTGAGGATG -3'
(R):5'- CTATCTGGAGACAAGAAGCA -3'
Posted On2016-09-01