Incidental Mutation 'R5412:Arid1a'
ID427521
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
MMRRC Submission 042981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5412 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 133719602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000139709] [ENSMUST00000145664]
Predicted Effect unknown
Transcript: ENSMUST00000008024
AA Change: T235A
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880
AA Change: T235A

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105897
AA Change: T620A
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880
AA Change: T620A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138473
Predicted Effect probably benign
Transcript: ENSMUST00000139709
SMART Domains Protein: ENSMUSP00000131950
Gene: ENSMUSG00000007880

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 140 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145664
AA Change: T620A
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880
AA Change: T620A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200408
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,978,752 N36Y probably damaging Het
Ankfn1 T A 11: 89,505,181 E246D probably benign Het
Bbs7 A T 3: 36,599,373 D300E probably benign Het
BC025446 A T 15: 75,217,820 E59V probably damaging Het
C3 T C 17: 57,220,187 D754G probably benign Het
Ccpg1 A T 9: 73,010,306 Q240L probably damaging Het
Cdk13 G A 13: 17,766,530 P650S probably damaging Het
Celsr2 G T 3: 108,399,995 S1933Y probably damaging Het
Cep135 T A 5: 76,616,862 H562Q probably benign Het
Cyp26a1 G T 19: 37,701,182 C442F probably damaging Het
Dnah7a T C 1: 53,635,344 S425G probably benign Het
Espn C T 4: 152,128,125 V752M probably damaging Het
Glyr1 A G 16: 5,036,433 S113P possibly damaging Het
Gm11127 C T 17: 36,056,044 C369Y probably benign Het
Grk4 A T 5: 34,745,268 Y388F probably benign Het
Heca C A 10: 17,902,296 V518F probably damaging Het
Hmcn2 C T 2: 31,346,617 P391S possibly damaging Het
Hnrnpl A G 7: 28,811,104 probably benign Het
Hsd3b2 A G 3: 98,711,892 S246P possibly damaging Het
Ifna11 C T 4: 88,820,143 P62L probably damaging Het
Katnal2 A T 18: 77,002,435 V292D probably damaging Het
Krt16 T A 11: 100,246,767 I371F probably damaging Het
Map10 A T 8: 125,670,985 L372F probably damaging Het
Megf10 A T 18: 57,191,147 M87L probably damaging Het
Ncoa6 T C 2: 155,407,781 H1201R possibly damaging Het
Ndc80 C A 17: 71,514,231 D241Y probably damaging Het
Ndufs1 T C 1: 63,166,349 M94V possibly damaging Het
Nkx2-6 G T 14: 69,174,746 R121L probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr2 A G 7: 107,001,635 V75A probably damaging Het
Otop1 A G 5: 38,297,984 I241V probably benign Het
Panx2 C A 15: 89,068,932 P542H possibly damaging Het
Pcdha5 C A 18: 36,962,457 P673Q probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Prdx6 A T 1: 161,244,290 I102N probably damaging Het
Prkd3 T A 17: 78,954,711 I725F possibly damaging Het
Selenon T C 4: 134,542,438 N395S probably benign Het
Serpinb8 G A 1: 107,605,886 E224K probably benign Het
Serpinb9b A G 13: 33,029,513 M18V probably benign Het
Smc6 A G 12: 11,285,399 E318G possibly damaging Het
Srrt A T 5: 137,296,287 Y786N probably damaging Het
Stk36 G T 1: 74,605,456 probably null Het
Stpg1 T A 4: 135,525,475 L179Q possibly damaging Het
Stra8 G A 6: 34,930,950 M1I probably null Het
Tiam1 G T 16: 89,884,865 H408Q possibly damaging Het
Tm2d1 G A 4: 98,365,618 T106I probably damaging Het
Tmem150b A C 7: 4,716,369 I184S probably null Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Vps13b G A 15: 35,533,385 A868T probably damaging Het
Wdr81 C T 11: 75,450,794 D1216N probably null Het
Zfp26 T C 9: 20,438,239 Y343C possibly damaging Het
Zfp276 A T 8: 123,255,781 I95F probably damaging Het
Zfp330 T C 8: 82,764,236 E315G probably benign Het
Zfp683 C A 4: 134,054,551 P56Q probably damaging Het
Zpld1 T A 16: 55,232,283 S323C possibly damaging Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
PIT4520001:Arid1a UTSW 4 133681916 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0631:Arid1a UTSW 4 133689170 missense unknown
R0648:Arid1a UTSW 4 133685204 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R1960:Arid1a UTSW 4 133753090 missense possibly damaging 0.84
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5540:Arid1a UTSW 4 133680454 missense unknown
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
X0064:Arid1a UTSW 4 133689260 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGCCTCGAAAACAGACAG -3'
(R):5'- TCTCCAGTTGCAACCTGGTTAG -3'

Sequencing Primer
(F):5'- GCACAAACTTATCCCTGATAAACAG -3'
(R):5'- AGGCAGGGTTTCTGTGTAATCC -3'
Posted On2016-09-01