Incidental Mutation 'R5414:Vmn2r3'
ID427620
Institutional Source Beutler Lab
Gene Symbol Vmn2r3
Ensembl Gene ENSMUSG00000091572
Gene Namevomeronasal 2, receptor 3
SynonymsEG637004
MMRRC Submission 042983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5414 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64258961-64287495 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 64259557 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 718 (R718*)
Ref Sequence ENSEMBL: ENSMUSP00000134891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170244] [ENSMUST00000176328]
Predicted Effect probably null
Transcript: ENSMUST00000170244
AA Change: R690*
SMART Domains Protein: ENSMUSP00000126165
Gene: ENSMUSG00000091572
AA Change: R690*

DomainStartEndE-ValueType
Pfam:ANF_receptor 64 479 4e-64 PFAM
Pfam:NCD3G 521 574 1.1e-17 PFAM
Pfam:7tm_3 605 842 2.9e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176328
AA Change: R718*
SMART Domains Protein: ENSMUSP00000134891
Gene: ENSMUSG00000091572
AA Change: R718*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 92 507 9.5e-66 PFAM
Pfam:NCD3G 549 602 8.8e-17 PFAM
Pfam:7tm_3 635 869 8.5e-48 PFAM
Meta Mutation Damage Score 0.6152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,314,622 S278P probably damaging Het
Acan A G 7: 79,100,988 T1836A probably benign Het
Akr1c18 T A 13: 4,136,735 D238V probably damaging Het
Akt3 A G 1: 177,050,251 V317A probably damaging Het
Atp2b2 G A 6: 113,842,141 P64S probably damaging Het
Atr A G 9: 95,870,704 N609S probably benign Het
Bcat1 A G 6: 145,015,447 probably null Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Cd34 A G 1: 194,947,911 E51G probably benign Het
Celsr3 A G 9: 108,840,042 E2161G possibly damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Cnih1 T C 14: 46,778,983 T105A probably benign Het
Coro1c A G 5: 113,848,546 I279T possibly damaging Het
Ddx11 A G 17: 66,148,768 T721A probably benign Het
Fbn2 C A 18: 58,093,405 A766S probably damaging Het
Focad C T 4: 88,410,702 probably benign Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp2b T C 3: 142,599,091 L96P probably damaging Het
Gm10192 T C 4: 97,183,109 S20G probably null Het
Gm10288 T C 3: 146,838,962 noncoding transcript Het
Gm21761 A C 13: 119,912,336 D139E probably damaging Het
Gm4181 C T 14: 51,635,590 probably null Het
Gm6327 T A 16: 12,760,358 noncoding transcript Het
Hfm1 A G 5: 106,902,076 I409T probably damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Ifit1bl1 T A 19: 34,593,924 I378F probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Krt33b T C 11: 100,029,786 T14A probably benign Het
Lrch3 T A 16: 32,985,965 probably null Het
Mycbp2 A T 14: 103,306,261 L226H probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nploc4 A T 11: 120,413,643 Y251N probably damaging Het
Olfr1271 T C 2: 90,265,702 T243A probably benign Het
Pdk4 T C 6: 5,485,499 I397V probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pgm5 A G 19: 24,709,325 I506T probably damaging Het
Pgs1 T G 11: 118,014,676 I499S probably damaging Het
Ppp6r3 A G 19: 3,507,330 S253P probably damaging Het
Prag1 C G 8: 36,139,622 P839R probably benign Het
Rin3 C T 12: 102,389,857 Q806* probably null Het
Ros1 T C 10: 52,155,093 D484G probably damaging Het
Scamp5 A G 9: 57,447,224 V49A probably benign Het
Sis C A 3: 72,952,493 V310L probably benign Het
Svep1 T C 4: 58,206,322 T19A possibly damaging Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Thra A G 11: 98,760,957 I102V probably benign Het
Trim30a A C 7: 104,411,141 V476G probably damaging Het
Washc4 A G 10: 83,556,103 T218A possibly damaging Het
Xrcc1 A G 7: 24,570,218 Y401C probably damaging Het
Zfp629 T C 7: 127,611,282 T452A probably damaging Het
Other mutations in Vmn2r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r3 APN 3 64259883 missense probably damaging 1.00
IGL01468:Vmn2r3 APN 3 64274961 missense possibly damaging 0.57
IGL02032:Vmn2r3 APN 3 64275055 missense possibly damaging 0.95
IGL02405:Vmn2r3 APN 3 64271199 splice site probably benign
IGL02640:Vmn2r3 APN 3 64287395 missense probably benign
IGL02719:Vmn2r3 APN 3 64275610 missense probably damaging 1.00
IGL02746:Vmn2r3 APN 3 64259818 missense possibly damaging 0.74
IGL02952:Vmn2r3 APN 3 64278835 missense probably damaging 1.00
IGL03390:Vmn2r3 APN 3 64275346 missense possibly damaging 0.55
R0023:Vmn2r3 UTSW 3 64275366 missense probably damaging 0.99
R0433:Vmn2r3 UTSW 3 64275633 missense possibly damaging 0.51
R0647:Vmn2r3 UTSW 3 64275625 missense probably damaging 1.00
R1071:Vmn2r3 UTSW 3 64275276 missense possibly damaging 0.79
R1536:Vmn2r3 UTSW 3 64275117 missense probably damaging 1.00
R1806:Vmn2r3 UTSW 3 64275472 missense probably benign 0.03
R1806:Vmn2r3 UTSW 3 64287389 missense possibly damaging 0.73
R1852:Vmn2r3 UTSW 3 64259394 missense probably damaging 1.00
R1868:Vmn2r3 UTSW 3 64259116 missense probably damaging 1.00
R2072:Vmn2r3 UTSW 3 64275072 missense possibly damaging 0.87
R2240:Vmn2r3 UTSW 3 64259062 missense probably benign 0.44
R2446:Vmn2r3 UTSW 3 64275312 missense probably damaging 0.98
R4133:Vmn2r3 UTSW 3 64275717 missense probably damaging 0.99
R4159:Vmn2r3 UTSW 3 64287429 nonsense probably null
R4494:Vmn2r3 UTSW 3 64275271 missense probably damaging 1.00
R4860:Vmn2r3 UTSW 3 64275601 missense probably benign 0.00
R4895:Vmn2r3 UTSW 3 64259761 missense probably benign 0.00
R4912:Vmn2r3 UTSW 3 64259197 missense probably damaging 1.00
R5018:Vmn2r3 UTSW 3 64271353 missense probably benign
R5033:Vmn2r3 UTSW 3 64259799 missense probably benign 0.09
R5126:Vmn2r3 UTSW 3 64259319 missense probably damaging 1.00
R5148:Vmn2r3 UTSW 3 64278826 missense probably damaging 1.00
R5785:Vmn2r3 UTSW 3 64259023 missense possibly damaging 0.89
R5905:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R5992:Vmn2r3 UTSW 3 64259647 missense probably damaging 1.00
R6028:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R6331:Vmn2r3 UTSW 3 64278761 missense probably damaging 1.00
R6378:Vmn2r3 UTSW 3 64275096 missense probably damaging 1.00
R6775:Vmn2r3 UTSW 3 64275618 missense possibly damaging 0.88
R6822:Vmn2r3 UTSW 3 64287455 missense probably benign 0.30
R6826:Vmn2r3 UTSW 3 64274906 nonsense probably null
R6886:Vmn2r3 UTSW 3 64259506 missense probably damaging 1.00
R6971:Vmn2r3 UTSW 3 64259247 missense probably damaging 0.99
R7154:Vmn2r3 UTSW 3 64287311 missense probably benign 0.02
R7192:Vmn2r3 UTSW 3 64259943 missense probably benign 0.24
R7282:Vmn2r3 UTSW 3 64261404 missense possibly damaging 0.90
X0022:Vmn2r3 UTSW 3 64271248 missense possibly damaging 0.62
X0022:Vmn2r3 UTSW 3 64274968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACGAGCCATAAAGGTTG -3'
(R):5'- GAGCTGAGCTTCCTCATTCAG -3'

Sequencing Primer
(F):5'- AACTCTACAGAACCTTCATTGCATTC -3'
(R):5'- CAGATATCTCTGGTTATCACAGTGC -3'
Posted On2016-09-01