Incidental Mutation 'R5414:Zfp629'
ID427636
Institutional Source Beutler Lab
Gene Symbol Zfp629
Ensembl Gene ENSMUSG00000045639
Gene Namezinc finger protein 629
Synonyms
MMRRC Submission 042983-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5414 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127607031-127615797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127611282 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 452 (T452A)
Ref Sequence ENSEMBL: ENSMUSP00000113903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058038] [ENSMUST00000084564] [ENSMUST00000122066] [ENSMUST00000128731] [ENSMUST00000131318] [ENSMUST00000132524] [ENSMUST00000134446] [ENSMUST00000151107] [ENSMUST00000152315]
Predicted Effect probably damaging
Transcript: ENSMUST00000058038
AA Change: T452A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053760
Gene: ENSMUSG00000045639
AA Change: T452A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084564
AA Change: T452A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081612
Gene: ENSMUSG00000045639
AA Change: T452A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122066
AA Change: T452A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113903
Gene: ENSMUSG00000045639
AA Change: T452A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128731
SMART Domains Protein: ENSMUSP00000140505
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131318
SMART Domains Protein: ENSMUSP00000116375
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132524
Predicted Effect probably benign
Transcript: ENSMUST00000134446
Predicted Effect probably benign
Transcript: ENSMUST00000151107
Predicted Effect probably benign
Transcript: ENSMUST00000152315
SMART Domains Protein: ENSMUSP00000114772
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 195 1.24e2 SMART
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,314,622 S278P probably damaging Het
Acan A G 7: 79,100,988 T1836A probably benign Het
Akr1c18 T A 13: 4,136,735 D238V probably damaging Het
Akt3 A G 1: 177,050,251 V317A probably damaging Het
Atp2b2 G A 6: 113,842,141 P64S probably damaging Het
Atr A G 9: 95,870,704 N609S probably benign Het
Bcat1 A G 6: 145,015,447 probably null Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Cd34 A G 1: 194,947,911 E51G probably benign Het
Celsr3 A G 9: 108,840,042 E2161G possibly damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Cnih1 T C 14: 46,778,983 T105A probably benign Het
Coro1c A G 5: 113,848,546 I279T possibly damaging Het
Ddx11 A G 17: 66,148,768 T721A probably benign Het
Fbn2 C A 18: 58,093,405 A766S probably damaging Het
Focad C T 4: 88,410,702 probably benign Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp2b T C 3: 142,599,091 L96P probably damaging Het
Gm10192 T C 4: 97,183,109 S20G probably null Het
Gm10288 T C 3: 146,838,962 noncoding transcript Het
Gm21761 A C 13: 119,912,336 D139E probably damaging Het
Gm4181 C T 14: 51,635,590 probably null Het
Gm6327 T A 16: 12,760,358 noncoding transcript Het
Hfm1 A G 5: 106,902,076 I409T probably damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Ifit1bl1 T A 19: 34,593,924 I378F probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Krt33b T C 11: 100,029,786 T14A probably benign Het
Lrch3 T A 16: 32,985,965 probably null Het
Mycbp2 A T 14: 103,306,261 L226H probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nploc4 A T 11: 120,413,643 Y251N probably damaging Het
Olfr1271 T C 2: 90,265,702 T243A probably benign Het
Pdk4 T C 6: 5,485,499 I397V probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pgm5 A G 19: 24,709,325 I506T probably damaging Het
Pgs1 T G 11: 118,014,676 I499S probably damaging Het
Ppp6r3 A G 19: 3,507,330 S253P probably damaging Het
Prag1 C G 8: 36,139,622 P839R probably benign Het
Rin3 C T 12: 102,389,857 Q806* probably null Het
Ros1 T C 10: 52,155,093 D484G probably damaging Het
Scamp5 A G 9: 57,447,224 V49A probably benign Het
Sis C A 3: 72,952,493 V310L probably benign Het
Svep1 T C 4: 58,206,322 T19A possibly damaging Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Thra A G 11: 98,760,957 I102V probably benign Het
Trim30a A C 7: 104,411,141 V476G probably damaging Het
Vmn2r3 T A 3: 64,259,557 R718* probably null Het
Washc4 A G 10: 83,556,103 T218A possibly damaging Het
Xrcc1 A G 7: 24,570,218 Y401C probably damaging Het
Other mutations in Zfp629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Zfp629 APN 7 127612724 missense probably damaging 0.97
IGL01541:Zfp629 APN 7 127612745 utr 5 prime probably benign
IGL02116:Zfp629 APN 7 127612718 missense probably damaging 1.00
IGL02134:Zfp629 APN 7 127611870 missense probably benign 0.22
IGL02547:Zfp629 APN 7 127611674 unclassified probably null
IGL02858:Zfp629 APN 7 127610312 missense probably damaging 1.00
IGL02867:Zfp629 APN 7 127610031 unclassified probably benign
IGL02889:Zfp629 APN 7 127610031 unclassified probably benign
R6768_Zfp629_044 UTSW 7 127610825 missense probably benign 0.03
R0020:Zfp629 UTSW 7 127611169 missense probably benign 0.02
R0137:Zfp629 UTSW 7 127611686 missense probably damaging 1.00
R0219:Zfp629 UTSW 7 127612083 missense probably damaging 1.00
R1061:Zfp629 UTSW 7 127611989 missense probably damaging 1.00
R1182:Zfp629 UTSW 7 127610102 missense probably damaging 1.00
R1187:Zfp629 UTSW 7 127610229 missense probably benign
R1187:Zfp629 UTSW 7 127611887 missense probably damaging 1.00
R1217:Zfp629 UTSW 7 127612744 start gained probably benign
R1507:Zfp629 UTSW 7 127611861 nonsense probably null
R1526:Zfp629 UTSW 7 127610759 missense possibly damaging 0.69
R1622:Zfp629 UTSW 7 127611840 missense probably damaging 1.00
R1704:Zfp629 UTSW 7 127610864 missense probably benign 0.06
R1918:Zfp629 UTSW 7 127612000 missense probably damaging 1.00
R2147:Zfp629 UTSW 7 127610444 missense probably damaging 1.00
R2156:Zfp629 UTSW 7 127612379 missense probably benign 0.00
R2258:Zfp629 UTSW 7 127611791 missense probably damaging 1.00
R2994:Zfp629 UTSW 7 127611056 missense probably damaging 0.99
R3735:Zfp629 UTSW 7 127612778 splice site probably benign
R4287:Zfp629 UTSW 7 127611938 missense probably damaging 1.00
R4610:Zfp629 UTSW 7 127612320 missense probably benign 0.26
R4758:Zfp629 UTSW 7 127610586 missense probably damaging 1.00
R4899:Zfp629 UTSW 7 127611018 missense possibly damaging 0.69
R4922:Zfp629 UTSW 7 127612127 missense probably damaging 1.00
R5772:Zfp629 UTSW 7 127611135 missense probably damaging 1.00
R5907:Zfp629 UTSW 7 127610370 missense probably damaging 1.00
R6768:Zfp629 UTSW 7 127610825 missense probably benign 0.03
R7122:Zfp629 UTSW 7 127611312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGGTTCTCGTCCATGTG -3'
(R):5'- CTGTGGCAAGACCTTCACAC -3'

Sequencing Primer
(F):5'- CGTCCATGTGTGTGCGGAC -3'
(R):5'- TGGCAAGACCTTCACACTGAGTG -3'
Posted On2016-09-01