Incidental Mutation 'R5414:Galnt16'
ID427653
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Namepolypeptide N-acetylgalactosaminyltransferase 16
Synonyms5730405L21Rik, Galntl1
MMRRC Submission 042983-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5414 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80518277-80630972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80584048 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 300 (D300V)
Ref Sequence ENSEMBL: ENSMUSP00000151829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
Predicted Effect probably damaging
Transcript: ENSMUST00000021558
AA Change: D300V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: D300V

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218648
Predicted Effect probably damaging
Transcript: ENSMUST00000218943
AA Change: D300V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219993
AA Change: D300V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220065
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,314,622 S278P probably damaging Het
Acan A G 7: 79,100,988 T1836A probably benign Het
Akr1c18 T A 13: 4,136,735 D238V probably damaging Het
Akt3 A G 1: 177,050,251 V317A probably damaging Het
Atp2b2 G A 6: 113,842,141 P64S probably damaging Het
Atr A G 9: 95,870,704 N609S probably benign Het
Bcat1 A G 6: 145,015,447 probably null Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Cd34 A G 1: 194,947,911 E51G probably benign Het
Celsr3 A G 9: 108,840,042 E2161G possibly damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Cnih1 T C 14: 46,778,983 T105A probably benign Het
Coro1c A G 5: 113,848,546 I279T possibly damaging Het
Ddx11 A G 17: 66,148,768 T721A probably benign Het
Fbn2 C A 18: 58,093,405 A766S probably damaging Het
Focad C T 4: 88,410,702 probably benign Het
Gbp2b T C 3: 142,599,091 L96P probably damaging Het
Gm10192 T C 4: 97,183,109 S20G probably null Het
Gm10288 T C 3: 146,838,962 noncoding transcript Het
Gm21761 A C 13: 119,912,336 D139E probably damaging Het
Gm4181 C T 14: 51,635,590 probably null Het
Gm6327 T A 16: 12,760,358 noncoding transcript Het
Hfm1 A G 5: 106,902,076 I409T probably damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Ifit1bl1 T A 19: 34,593,924 I378F probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Krt33b T C 11: 100,029,786 T14A probably benign Het
Lrch3 T A 16: 32,985,965 probably null Het
Mycbp2 A T 14: 103,306,261 L226H probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nploc4 A T 11: 120,413,643 Y251N probably damaging Het
Olfr1271 T C 2: 90,265,702 T243A probably benign Het
Pdk4 T C 6: 5,485,499 I397V probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pgm5 A G 19: 24,709,325 I506T probably damaging Het
Pgs1 T G 11: 118,014,676 I499S probably damaging Het
Ppp6r3 A G 19: 3,507,330 S253P probably damaging Het
Prag1 C G 8: 36,139,622 P839R probably benign Het
Rin3 C T 12: 102,389,857 Q806* probably null Het
Ros1 T C 10: 52,155,093 D484G probably damaging Het
Scamp5 A G 9: 57,447,224 V49A probably benign Het
Sis C A 3: 72,952,493 V310L probably benign Het
Svep1 T C 4: 58,206,322 T19A possibly damaging Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Thra A G 11: 98,760,957 I102V probably benign Het
Trim30a A C 7: 104,411,141 V476G probably damaging Het
Vmn2r3 T A 3: 64,259,557 R718* probably null Het
Washc4 A G 10: 83,556,103 T218A possibly damaging Het
Xrcc1 A G 7: 24,570,218 Y401C probably damaging Het
Zfp629 T C 7: 127,611,282 T452A probably damaging Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80592490 splice site probably null
IGL02614:Galnt16 APN 12 80576563 missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80592417 nonsense probably null
R0032:Galnt16 UTSW 12 80592469 missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80590631 missense probably benign
R1560:Galnt16 UTSW 12 80601792 missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80590636 missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80584077 missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80572329 nonsense probably null
R5140:Galnt16 UTSW 12 80581299 missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80584048 missense probably damaging 1.00
R5592:Galnt16 UTSW 12 80588519 missense probably damaging 1.00
R6433:Galnt16 UTSW 12 80575903 missense probably benign 0.44
R6634:Galnt16 UTSW 12 80519170 start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80580052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGAGGACTGTGACCATG -3'
(R):5'- TTAGCCATTTGGTCACAGGCTC -3'

Sequencing Primer
(F):5'- TGGGAACAGTCGTGAGGCC -3'
(R):5'- TACCTCAAAGGGCCCTTATGATG -3'
Posted On2016-09-01