Incidental Mutation 'R5415:Gstm5'
ID427675
Institutional Source Beutler Lab
Gene Symbol Gstm5
Ensembl Gene ENSMUSG00000004032
Gene Nameglutathione S-transferase, mu 5
Synonyms
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107895821-107898686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107897495 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 101 (D101G)
Ref Sequence ENSEMBL: ENSMUSP00000129426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000167387] [ENSMUST00000167523] [ENSMUST00000169365] [ENSMUST00000170058] [ENSMUST00000172247]
Predicted Effect probably damaging
Transcript: ENSMUST00000004134
AA Change: D101G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: D101G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037375
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163675
Predicted Effect probably damaging
Transcript: ENSMUST00000167387
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032
AA Change: D35G

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167523
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169365
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032
AA Change: D35G

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170058
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172247
AA Change: D101G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: D101G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Gstm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Gstm5 APN 3 107897558 missense probably benign 0.11
IGL02219:Gstm5 APN 3 107898031 missense probably damaging 1.00
R0685:Gstm5 UTSW 3 107897319 missense probably damaging 1.00
R2364:Gstm5 UTSW 3 107896371 missense probably benign 0.00
R3836:Gstm5 UTSW 3 107896362 missense probably benign 0.00
R4600:Gstm5 UTSW 3 107897986 missense probably damaging 1.00
R5097:Gstm5 UTSW 3 107895942 start gained probably benign
R5369:Gstm5 UTSW 3 107898466 missense probably damaging 1.00
R5689:Gstm5 UTSW 3 107896665 missense probably damaging 0.97
R5832:Gstm5 UTSW 3 107897537 missense probably benign 0.01
R5988:Gstm5 UTSW 3 107895954 start codon destroyed probably benign
R7329:Gstm5 UTSW 3 107896331 missense possibly damaging 0.69
R7546:Gstm5 UTSW 3 107897294 missense not run
X0020:Gstm5 UTSW 3 107895966 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CAGAGTAACGCCATCCTGAG -3'
(R):5'- GAGCTAACACCAGACTTACAGG -3'

Sequencing Primer
(F):5'- GTAACGCCATCCTGAGATACATCG -3'
(R):5'- CTAATCCTTCCAGTTTGGGTTGATAG -3'
Posted On2016-09-01