Mutagenetix > Incidental Mutation

Incidental Mutation 'R5415:Gstm5'

427675

Institutional Source

Beutler Lab

Gene Symbol

Gstm5

Ensembl Gene

ENSMUSG00000004032

Gene Name

glutathione S-transferase, mu 5

Synonyms

MMRRC Submission

042984-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107803240-107806002 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107804811 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 101 (D101G)

Ref Sequence

ENSEMBL: ENSMUSP00000129426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000169365] [ENSMUST00000167387] [ENSMUST00000172247] [ENSMUST00000170058] [ENSMUST00000167523]

AlphaFold

P48774

Predicted Effect

probably damaging
Transcript: ENSMUST00000004134
AA Change: D101G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: D101G

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	85	4e-23	PFAM
Pfam:GST_C	107	195	1.5e-19	PFAM
Pfam:GST_C_3	113	193	2.9e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000037375

SMART Domains

Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

Domain	Start	End	E-Value	Type
Pfam:PTB	28	155	3.7e-40	PFAM
low complexity region	204	214	N/A	INTRINSIC
low complexity region	230	247	N/A	INTRINSIC
low complexity region	273	285	N/A	INTRINSIC
SH3	460	515	5.19e-15	SMART
PDB:2E8M\|A	516	582	3e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131345

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133570

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137970

Predicted Effect

probably damaging
Transcript: ENSMUST00000169365
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032
AA Change: D35G

Domain	Start	End	E-Value	Type
Pfam:GST_C	41	129	2.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167387
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032
AA Change: D35G

Domain	Start	End	E-Value	Type
Pfam:GST_C	41	129	2.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172247
AA Change: D101G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: D101G

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	85	2.1e-21	PFAM
Pfam:GST_C	107	193	2.2e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146337

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152663

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145191

Predicted Effect

probably benign
Transcript: ENSMUST00000170058

SMART Domains

Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	55	3.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167523

SMART Domains

Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	67	6.2e-11	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef18	G	A	8: 3,438,075 (GRCm39)	R303H	probably damaging	Het
Ark2c	C	A	18: 77,554,435 (GRCm39)	V60L	probably damaging	Het
Asb15	A	T	6: 24,570,690 (GRCm39)	Q556L	probably benign	Het
Ccr1	G	T	9: 123,764,413 (GRCm39)	P39H	probably damaging	Het
Cd177	A	T	7: 24,451,816 (GRCm39)	L400Q	probably damaging	Het
Cfap298	G	T	16: 90,722,953 (GRCm39)	D260E	probably benign	Het
Cideb	T	C	14: 55,995,312 (GRCm39)	E58G	probably damaging	Het
Drd2	A	G	9: 49,313,553 (GRCm39)	K241E	possibly damaging	Het
Ect2	C	T	3: 27,201,002 (GRCm39)	C126Y	probably damaging	Het
Eef1d	T	C	15: 75,775,030 (GRCm39)	T210A	probably benign	Het
Enpp2	G	A	15: 54,745,552 (GRCm39)	H315Y	probably damaging	Het
Ero1b	A	T	13: 12,616,656 (GRCm39)	M362L	probably benign	Het
Exosc2	A	G	2: 31,562,578 (GRCm39)	K73E	possibly damaging	Het
Gm9637	T	A	14: 19,402,143 (GRCm38)		noncoding transcript	Het
Igkv4-80	A	C	6: 68,993,649 (GRCm39)	S81A	probably benign	Het
Kmt2c	T	C	5: 25,519,699 (GRCm39)	D2137G	probably benign	Het
Mecom	T	C	3: 30,011,675 (GRCm39)	D619G	possibly damaging	Het
Met	A	G	6: 17,527,084 (GRCm39)	I512V	probably benign	Het
Myh15	A	G	16: 48,937,658 (GRCm39)	K753R	probably null	Het
Nfatc4	A	G	14: 56,070,091 (GRCm39)	D753G	probably benign	Het
Or2l5	T	A	16: 19,333,996 (GRCm39)	H130L	possibly damaging	Het
Or4c113	T	A	2: 88,885,240 (GRCm39)	T177S	probably benign	Het
Or4c12	T	A	2: 89,773,731 (GRCm39)	T243S	probably benign	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Parp9	C	T	16: 35,763,752 (GRCm39)	A10V	probably damaging	Het
Pcdh8	C	A	14: 80,007,688 (GRCm39)	E292*	probably null	Het
Pdpn	A	T	4: 142,995,788 (GRCm39)	V161D	probably damaging	Het
Peg3	A	G	7: 6,711,628 (GRCm39)	V1198A	probably benign	Het
Phykpl	T	C	11: 51,476,342 (GRCm39)	S21P	probably benign	Het
Plcb1	G	T	2: 135,189,322 (GRCm39)	V817F	possibly damaging	Het
Polk	T	C	13: 96,620,463 (GRCm39)	Y579C	probably benign	Het
Ppp1r18	A	G	17: 36,178,511 (GRCm39)	N129D	probably benign	Het
Psg29	C	A	7: 16,945,561 (GRCm39)		probably null	Het
Rims4	C	T	2: 163,760,596 (GRCm39)	R3H	probably benign	Het
Rps6kl1	A	T	12: 85,186,155 (GRCm39)	C292S	probably benign	Het
Uaca	G	T	9: 60,777,421 (GRCm39)	G603C	possibly damaging	Het
Vmn1r60	T	C	7: 5,547,416 (GRCm39)	H228R	probably benign	Het
Vmn2r7	T	C	3: 64,623,658 (GRCm39)	T221A	probably benign	Het
Zfp647	C	A	15: 76,795,593 (GRCm39)	V356L	possibly damaging	Het

Other mutations in Gstm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Gstm5	APN	3	107,804,874 (GRCm39)	missense	probably benign	0.11
IGL02219:Gstm5	APN	3	107,805,347 (GRCm39)	missense	probably damaging	1.00
R0685:Gstm5	UTSW	3	107,804,635 (GRCm39)	missense	probably damaging	1.00
R2364:Gstm5	UTSW	3	107,803,687 (GRCm39)	missense	probably benign	0.00
R3836:Gstm5	UTSW	3	107,803,678 (GRCm39)	missense	probably benign	0.00
R4600:Gstm5	UTSW	3	107,805,302 (GRCm39)	missense	probably damaging	1.00
R5097:Gstm5	UTSW	3	107,803,258 (GRCm39)	start gained	probably benign
R5369:Gstm5	UTSW	3	107,805,782 (GRCm39)	missense	probably damaging	1.00
R5689:Gstm5	UTSW	3	107,803,981 (GRCm39)	missense	probably damaging	0.97
R5832:Gstm5	UTSW	3	107,804,853 (GRCm39)	missense	probably benign	0.01
R5988:Gstm5	UTSW	3	107,803,270 (GRCm39)	start codon destroyed	probably benign
R7329:Gstm5	UTSW	3	107,803,647 (GRCm39)	missense	possibly damaging	0.69
R7546:Gstm5	UTSW	3	107,804,610 (GRCm39)	missense	probably damaging	1.00
R9222:Gstm5	UTSW	3	107,804,634 (GRCm39)	missense	probably benign	0.09
X0020:Gstm5	UTSW	3	107,803,282 (GRCm39)	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CAGAGTAACGCCATCCTGAG -3'
(R):5'- GAGCTAACACCAGACTTACAGG -3'

Sequencing Primer
(F):5'- GTAACGCCATCCTGAGATACATCG -3'
(R):5'- CTAATCCTTCCAGTTTGGGTTGATAG -3'

Posted On

2016-09-01