Incidental Mutation 'R5415:Pdpn'
ID427677
Institutional Source Beutler Lab
Gene Symbol Pdpn
Ensembl Gene ENSMUSG00000028583
Gene Namepodoplanin
SynonymsT1alpha, Gp38, T1a, OTS-8, PA2.26, RANDAM-2
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143267431-143299564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143269218 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 161 (V161D)
Ref Sequence ENSEMBL: ENSMUSP00000030317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030317] [ENSMUST00000119654]
PDB Structure
Crystal Structure of 237mAb with antigen [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030317
AA Change: V161D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030317
Gene: ENSMUSG00000028583
AA Change: V161D

DomainStartEndE-ValueType
Pfam:Podoplanin 1 171 3.6e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119654
AA Change: V148D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113776
Gene: ENSMUSG00000028583
AA Change: V148D

DomainStartEndE-ValueType
Pfam:Podoplanin 1 159 4.8e-84 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null neonates die exhibiting respiratory failure. Mice homozygous for another knock-out allele exhibit blood-lymph mixing and intestinal edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Pdpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Pdpn APN 4 143270570 intron probably benign
IGL02307:Pdpn APN 4 143273980 missense possibly damaging 0.59
PIT4243001:Pdpn UTSW 4 143270538 missense probably damaging 0.99
R1221:Pdpn UTSW 4 143274038 missense probably damaging 0.98
R5364:Pdpn UTSW 4 143273956 missense possibly damaging 0.93
R6180:Pdpn UTSW 4 143299222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGAGATCAGATCAGAGGCTGC -3'
(R):5'- TCAGCTGGACTTGGGAGACTAG -3'

Sequencing Primer
(F):5'- ATCAGATCAGAGGCTGCGTCTG -3'
(R):5'- GGAGACTAGACGAGCCCATTC -3'
Posted On2016-09-01