Incidental Mutation 'R5415:Ero1lb'
ID427691
Institutional Source Beutler Lab
Gene Symbol Ero1lb
Ensembl Gene ENSMUSG00000057069
Gene NameERO1-like beta (S. cerevisiae)
Synonyms
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12565874-12611396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12601767 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 362 (M362L)
Ref Sequence ENSEMBL: ENSMUSP00000152393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071973] [ENSMUST00000220811] [ENSMUST00000221560]
Predicted Effect probably benign
Transcript: ENSMUST00000071973
AA Change: M362L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071864
Gene: ENSMUSG00000057069
AA Change: M362L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:ERO1 56 456 2.5e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220811
AA Change: M362L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000221560
AA Change: M362L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221739
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased circulating glucose levels, decreased pancreas insulin levels, and disorganized islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Ero1lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Ero1lb APN 13 12601734 critical splice acceptor site probably null
IGL02738:Ero1lb APN 13 12604433 missense possibly damaging 0.94
IGL03033:Ero1lb APN 13 12581670 missense probably damaging 1.00
R0607:Ero1lb UTSW 13 12574866 missense probably damaging 1.00
R0801:Ero1lb UTSW 13 12581687 missense probably benign 0.10
R1665:Ero1lb UTSW 13 12579261 critical splice donor site probably null
R1851:Ero1lb UTSW 13 12604403 missense possibly damaging 0.61
R1928:Ero1lb UTSW 13 12601759 missense probably damaging 1.00
R2910:Ero1lb UTSW 13 12600289 missense probably damaging 1.00
R3719:Ero1lb UTSW 13 12583612 critical splice donor site probably null
R4873:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R4875:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R5053:Ero1lb UTSW 13 12599906 missense probably damaging 1.00
R5338:Ero1lb UTSW 13 12574851 missense probably damaging 1.00
R5800:Ero1lb UTSW 13 12602301 splice site probably null
R5907:Ero1lb UTSW 13 12600318 missense probably damaging 0.98
R5909:Ero1lb UTSW 13 12579258 missense probably benign 0.18
R6029:Ero1lb UTSW 13 12574833 missense probably damaging 1.00
R7234:Ero1lb UTSW 13 12600314 missense possibly damaging 0.72
R7331:Ero1lb UTSW 13 12600126 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTAAGATACTGCATCCTTAAGA -3'
(R):5'- TGTAAATTCATCATGCCACACTGT -3'

Sequencing Primer
(F):5'- GATATGCCTACCCAATCCTGTTAAG -3'
(R):5'- ATGCCACACTGTGCCACTG -3'
Posted On2016-09-01