Incidental Mutation 'R5415:Pcdh8'
ID427696
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Nameprotocadherin 8
Synonyms1700080P15Rik, Papc
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79766775-79771312 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 79770248 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 292 (E292*)
Ref Sequence ENSEMBL: ENSMUSP00000141417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
Predicted Effect probably null
Transcript: ENSMUST00000039568
AA Change: E292*
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: E292*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195034
Predicted Effect probably null
Transcript: ENSMUST00000195355
AA Change: E292*
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: E292*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 79769246 missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 79767667 missense probably benign 0.00
R0094:Pcdh8 UTSW 14 79768148 missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 79767408 missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 79770076 missense probably damaging 1.00
R0681:Pcdh8 UTSW 14 79769960 missense probably benign
R0718:Pcdh8 UTSW 14 79770691 missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 79767726 missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 79769547 missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 79769389 missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 79770607 missense probably benign 0.20
R1556:Pcdh8 UTSW 14 79770403 missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 79768134 missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2068:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 79768714 missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 79770266 missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 79767513 missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 79768270 missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 79770868 missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 79767655 missense probably benign 0.09
R5187:Pcdh8 UTSW 14 79770154 missense probably damaging 0.99
R5548:Pcdh8 UTSW 14 79767502 missense probably damaging 1.00
R5749:Pcdh8 UTSW 14 79770085 missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 79770757 missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 79770980 missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 79767651 missense probably benign 0.02
R7653:Pcdh8 UTSW 14 79767646 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGAGCGTTGTCGTTGAC -3'
(R):5'- TGCTGCTACAGGAGTTGGAC -3'

Sequencing Primer
(F):5'- TTGACGTCTCGGATGCGC -3'
(R):5'- CTACAGGAGTTGGACCGCGAG -3'
Posted On2016-09-01