Incidental Mutation 'R5415:Eef1d'
ID427698
Institutional Source Beutler Lab
Gene Symbol Eef1d
Ensembl Gene ENSMUSG00000055762
Gene Nameeukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Synonyms
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R5415 (G1)
Quality Score127
Status Not validated
Chromosome15
Chromosomal Location75894205-75909556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75903181 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 210 (T210A)
Ref Sequence ENSEMBL: ENSMUSP00000123388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000127550] [ENSMUST00000137426] [ENSMUST00000141268] [ENSMUST00000141475] [ENSMUST00000144614] [ENSMUST00000145764] [ENSMUST00000151066] [ENSMUST00000154584]
Predicted Effect probably benign
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055220
Predicted Effect probably benign
Transcript: ENSMUST00000089680
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089681
AA Change: T210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762
AA Change: T210A

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109972
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109975
AA Change: T210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762
AA Change: T210A

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116440
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127550
SMART Domains Protein: ENSMUSP00000120735
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129800
Predicted Effect probably benign
Transcript: ENSMUST00000137426
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114753
Gene: ENSMUSG00000055762
AA Change: T126A

DomainStartEndE-ValueType
low complexity region 53 72 N/A INTRINSIC
internal_repeat_1 160 179 9.48e-6 PROSPERO
internal_repeat_1 305 324 9.48e-6 PROSPERO
low complexity region 330 346 N/A INTRINSIC
coiled coil region 353 391 N/A INTRINSIC
EF-1_beta_acid 430 457 2.53e-4 SMART
EF1_GNE 466 552 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141475
AA Change: T210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123388
Gene: ENSMUSG00000055762
AA Change: T210A

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_1 122 136 7.17e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_1 174 188 7.17e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145764
SMART Domains Protein: ENSMUSP00000117782
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151066
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154584
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Eef1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Eef1d APN 15 75896855 missense probably benign 0.10
IGL02265:Eef1d APN 15 75903434 missense probably benign 0.00
IGL02609:Eef1d APN 15 75896313 missense probably null 1.00
IGL02671:Eef1d APN 15 75895805 missense probably damaging 1.00
IGL02728:Eef1d APN 15 75903096 missense probably damaging 1.00
PIT4131001:Eef1d UTSW 15 75903732 missense probably benign 0.01
R0034:Eef1d UTSW 15 75902959 missense probably benign
R0523:Eef1d UTSW 15 75903156 missense probably benign
R0831:Eef1d UTSW 15 75896806 unclassified probably benign
R1164:Eef1d UTSW 15 75902677 critical splice donor site probably null
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1594:Eef1d UTSW 15 75896346 missense probably damaging 1.00
R1796:Eef1d UTSW 15 75901175 missense probably damaging 1.00
R2039:Eef1d UTSW 15 75895769 missense probably damaging 1.00
R2093:Eef1d UTSW 15 75902701 missense probably benign 0.00
R2119:Eef1d UTSW 15 75903213 missense probably benign 0.43
R2372:Eef1d UTSW 15 75896317 missense probably damaging 1.00
R4401:Eef1d UTSW 15 75902920 missense probably benign
R4403:Eef1d UTSW 15 75902920 missense probably benign
R4425:Eef1d UTSW 15 75902799 missense possibly damaging 0.92
R4614:Eef1d UTSW 15 75903576 missense probably benign 0.00
R4791:Eef1d UTSW 15 75903682 missense possibly damaging 0.85
R4864:Eef1d UTSW 15 75903406 missense possibly damaging 0.73
R5376:Eef1d UTSW 15 75903189 missense probably benign 0.25
R5377:Eef1d UTSW 15 75903189 missense probably benign 0.25
R6966:Eef1d UTSW 15 75903709 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATGACCATCAAACAGGGCC -3'
(R):5'- AGAAAGCTCCTACCGTCAGAGG -3'

Sequencing Primer
(F):5'- AGGGCCTCATAGAAGCCC -3'
(R):5'- AGATGTAGCTGCCCAGGC -3'
Posted On2016-09-01