Incidental Mutation 'R5416:Adcy3'
ID427750
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Nameadenylate cyclase 3
SynonymsAC3
MMRRC Submission 042985-MU
Accession Numbers

Ncbi RefSeq: NM_138305.3, NM_001159536.1, NM_001159537.1; MGI:99675

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R5416 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4133103-4213525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4209308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 861 (E861K)
Ref Sequence ENSEMBL: ENSMUSP00000115644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020984
AA Change: E862K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654
AA Change: E862K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124505
AA Change: E861K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654
AA Change: E861K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127110
Predicted Effect probably damaging
Transcript: ENSMUST00000127756
AA Change: E862K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654
AA Change: E862K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably damaging
Transcript: ENSMUST00000152065
AA Change: E861K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654
AA Change: E861K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 2661086; 3604495
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,907,596 E689D probably damaging Het
Acsl6 A G 11: 54,337,171 E339G probably benign Het
Adrm1 C T 2: 180,176,137 T394I probably benign Het
Adsl T A 15: 80,952,183 probably null Het
Asxl3 T A 18: 22,524,494 C1854S probably damaging Het
C87436 A G 6: 86,465,850 Y458C probably damaging Het
Cacna1e T C 1: 154,465,779 D1161G probably damaging Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cdh18 A G 15: 23,226,723 Y90C probably damaging Het
Chadl T C 15: 81,693,899 R510G probably benign Het
Clcnkb T C 4: 141,413,900 T115A probably benign Het
Clptm1 C A 7: 19,633,816 probably benign Het
Col24a1 A T 3: 145,315,025 R386* probably null Het
Ctsj G T 13: 61,004,523 L10M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx40 T C 11: 86,797,691 D302G probably benign Het
Edrf1 T C 7: 133,641,402 F166L possibly damaging Het
Epha1 A T 6: 42,365,871 M248K probably damaging Het
Evpl C A 11: 116,234,259 V126L probably benign Het
Fam83d T C 2: 158,785,632 C414R possibly damaging Het
Fat2 T C 11: 55,303,688 N1175S possibly damaging Het
Fhad1 G A 4: 141,918,802 T283I probably benign Het
Fuca1 A G 4: 135,922,980 T121A probably damaging Het
Gm13941 A T 2: 111,094,734 S175T unknown Het
Gpr107 T A 2: 31,185,548 I357N probably damaging Het
Gpr161 T A 1: 165,321,461 H466Q probably benign Het
Hsd3b5 A G 3: 98,619,150 F327L probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Itgb7 A T 15: 102,217,309 D628E probably benign Het
Nwd1 A G 8: 72,666,694 D236G possibly damaging Het
Olfr214 A T 6: 116,557,205 Y260F probably damaging Het
Olfr663 C T 7: 104,703,716 L50F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 A G 18: 37,356,955 Y562C probably damaging Het
Phkg2 A G 7: 127,582,935 H376R possibly damaging Het
Plxnc1 G A 10: 94,837,554 T1018I probably damaging Het
Ppp6r1 A T 7: 4,639,748 D532E possibly damaging Het
Prkdc T C 16: 15,805,950 L3259P probably damaging Het
Prkg2 A T 5: 98,943,467 D641E probably benign Het
Psg26 T C 7: 18,482,600 T105A probably benign Het
Ptprs T C 17: 56,435,724 T473A probably damaging Het
Pwp2 G T 10: 78,183,001 N57K probably damaging Het
Rnf216 G T 5: 143,015,771 C733* probably null Het
Serpina1f T A 12: 103,693,944 K26N possibly damaging Het
Sez6l2 T A 7: 126,961,886 C448S probably damaging Het
Slc28a3 A T 13: 58,576,793 L216M probably damaging Het
Sorbs1 A G 19: 40,376,989 S117P probably benign Het
Sorl1 A T 9: 42,002,636 C1332* probably null Het
Specc1 T C 11: 62,118,909 V497A probably benign Het
Tmem204 T C 17: 25,058,326 E195G probably damaging Het
Tnfrsf13b T C 11: 61,147,023 probably null Het
Ttll5 G A 12: 86,012,828 V1250M possibly damaging Het
Ube4a G A 9: 44,941,178 T681I probably damaging Het
Ubqln3 C T 7: 104,141,672 V404I probably benign Het
Yeats2 T C 16: 20,211,569 S919P probably benign Het
Zfp575 C T 7: 24,586,722 G3D probably benign Het
Zfp644 C T 5: 106,618,428 silent Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4194357 missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4134600 missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4201213 missense probably benign 0.00
IGL02097:Adcy3 APN 12 4212118 missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4134699 missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4134390 missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4212142 nonsense probably null
IGL02376:Adcy3 APN 12 4201031 missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4209407 unclassified probably null
IGL02465:Adcy3 APN 12 4200906 missense probably benign 0.10
IGL02819:Adcy3 APN 12 4206986 splice site probably benign
magnificent_frigatebird UTSW 12 4194324 missense
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0918:Adcy3 UTSW 12 4198360 missense probably benign 0.05
R1480:Adcy3 UTSW 12 4212171 missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4200998 missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4134951 missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4173450 splice site probably benign
R1951:Adcy3 UTSW 12 4208624 missense probably benign 0.29
R2083:Adcy3 UTSW 12 4173512 missense probably damaging 1.00
R2417:Adcy3 UTSW 12 4208627 missense probably benign 0.05
R4379:Adcy3 UTSW 12 4134558 missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4206542 missense probably benign 0.00
R4960:Adcy3 UTSW 12 4134896 missense probably benign 0.11
R5001:Adcy3 UTSW 12 4198434 missense possibly damaging 0.56
R5166:Adcy3 UTSW 12 4134438 missense probably damaging 1.00
R5375:Adcy3 UTSW 12 4210870 missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4198348 missense probably damaging 1.00
R6248:Adcy3 UTSW 12 4208662 critical splice donor site probably null
R6490:Adcy3 UTSW 12 4212150 missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4194324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGTATCAAGAGGCCCAGG -3'
(R):5'- CTTGACTCAGTGCTCCTCAG -3'

Sequencing Primer
(F):5'- TATCAAGAGGCCCAGGTCCTTAATG -3'
(R):5'- TTGACTCAGTGCTCCTCAGAGAAAG -3'
Posted On2016-09-01