Incidental Mutation 'R5417:Olfr1301'
ID427777
Institutional Source Beutler Lab
Gene Symbol Olfr1301
Ensembl Gene ENSMUSG00000057149
Gene Nameolfactory receptor 1301
SynonymsGA_x6K02T2Q125-72805651-72806589, MOR248-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111751006-111758852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111754920 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000146530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080094] [ENSMUST00000207590]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080094
AA Change: T224A

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078993
Gene: ENSMUSG00000057149
AA Change: T224A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-53 PFAM
Pfam:7tm_1 41 287 2.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207590
AA Change: T224A

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Olfr1301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Olfr1301 APN 2 111754426 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754603 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754503 missense probably benign 0.01
IGL01538:Olfr1301 APN 2 111755005 missense probably damaging 0.98
IGL01795:Olfr1301 APN 2 111754386 missense probably benign 0.00
IGL02007:Olfr1301 APN 2 111754479 missense probably damaging 0.99
IGL02738:Olfr1301 APN 2 111754354 missense probably damaging 1.00
IGL03365:Olfr1301 APN 2 111754427 missense possibly damaging 0.95
R0014:Olfr1301 UTSW 2 111754774 missense probably damaging 1.00
R0115:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R0481:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R1441:Olfr1301 UTSW 2 111755002 missense probably damaging 1.00
R1583:Olfr1301 UTSW 2 111754425 missense probably damaging 0.98
R2091:Olfr1301 UTSW 2 111754386 missense probably benign 0.00
R2301:Olfr1301 UTSW 2 111754276 missense probably benign 0.01
R2363:Olfr1301 UTSW 2 111754794 missense probably damaging 0.97
R2511:Olfr1301 UTSW 2 111754316 missense probably benign 0.00
R3686:Olfr1301 UTSW 2 111754569 missense probably benign 0.00
R4841:Olfr1301 UTSW 2 111754334 missense probably benign 0.00
R4915:Olfr1301 UTSW 2 111754380 missense probably benign 0.00
R4961:Olfr1301 UTSW 2 111754405 missense probably damaging 1.00
R5123:Olfr1301 UTSW 2 111754552 missense probably damaging 1.00
R5654:Olfr1301 UTSW 2 111754981 missense probably damaging 1.00
R5753:Olfr1301 UTSW 2 111754801 missense possibly damaging 0.51
R6361:Olfr1301 UTSW 2 111754595 missense probably damaging 1.00
R6525:Olfr1301 UTSW 2 111754984 missense probably benign 0.09
R6682:Olfr1301 UTSW 2 111754635 missense probably damaging 1.00
R7099:Olfr1301 UTSW 2 111755076 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCAACTGCCTCTCTGTG -3'
(R):5'- ACAAAGACTTTTCTTGGCCTTAAG -3'

Sequencing Primer
(F):5'- CTCTGTGGTCATATGGAAATTGACAG -3'
(R):5'- AGTGTATAAATGGCTGGATTTAGGAG -3'
Posted On2016-09-01