Incidental Mutation 'R5417:Pgm2l1'
ID427785
Institutional Source Beutler Lab
Gene Symbol Pgm2l1
Ensembl Gene ENSMUSG00000030729
Gene Namephosphoglucomutase 2-like 1
Synonyms4931406N15Rik, BM32A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100227394-100278868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100272376 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 605 (I605L)
Ref Sequence ENSEMBL: ENSMUSP00000081998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054436] [ENSMUST00000084935] [ENSMUST00000162108]
Predicted Effect probably benign
Transcript: ENSMUST00000054436
AA Change: I605L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054782
Gene: ENSMUSG00000030729
AA Change: I605L

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 2.5e-36 PFAM
Pfam:PGM_PMM_II 237 347 2e-25 PFAM
Pfam:PGM_PMM_III 353 481 5.4e-15 PFAM
Pfam:PGM_PMM_IV 524 604 5.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084935
AA Change: I605L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081998
Gene: ENSMUSG00000030729
AA Change: I605L

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 4e-36 PFAM
Pfam:PGM_PMM_II 237 347 2.4e-26 PFAM
Pfam:PGM_PMM_III 353 481 8e-16 PFAM
Pfam:PGM_PMM_IV 526 601 8.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162108
SMART Domains Protein: ENSMUSP00000124851
Gene: ENSMUSG00000030729

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 4e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Pgm2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Pgm2l1 APN 7 100255619 critical splice donor site probably null
R0044:Pgm2l1 UTSW 7 100250332 missense probably benign 0.01
R0044:Pgm2l1 UTSW 7 100250332 missense probably benign 0.01
R0106:Pgm2l1 UTSW 7 100250373 missense probably benign 0.07
R0106:Pgm2l1 UTSW 7 100250373 missense probably benign 0.07
R0394:Pgm2l1 UTSW 7 100252198 missense probably damaging 1.00
R1518:Pgm2l1 UTSW 7 100261725 missense probably benign 0.00
R2184:Pgm2l1 UTSW 7 100268155 missense possibly damaging 0.82
R2207:Pgm2l1 UTSW 7 100268112 splice site probably null
R2344:Pgm2l1 UTSW 7 100259908 missense probably damaging 0.99
R3804:Pgm2l1 UTSW 7 100252267 missense probably benign 0.00
R4292:Pgm2l1 UTSW 7 100250301 missense probably damaging 1.00
R4789:Pgm2l1 UTSW 7 100267587 missense probably benign
R4872:Pgm2l1 UTSW 7 100227997 missense probably damaging 1.00
R5001:Pgm2l1 UTSW 7 100272376 missense probably benign 0.00
R5081:Pgm2l1 UTSW 7 100268265 missense probably benign
R5181:Pgm2l1 UTSW 7 100261758 missense probably benign 0.01
R5500:Pgm2l1 UTSW 7 100268133 missense probably benign 0.00
R6057:Pgm2l1 UTSW 7 100266674 missense probably benign 0.33
R6414:Pgm2l1 UTSW 7 100255540 missense possibly damaging 0.88
R7356:Pgm2l1 UTSW 7 100268119 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCAGTCCAGTGTTAGCTTG -3'
(R):5'- ATTTAGCCAGCTGAACACAGG -3'

Sequencing Primer
(F):5'- CAGTCCAGTGTTAGCTTGTGACTG -3'
(R):5'- CCAGCTGAACACAGGAAAGAAAAG -3'
Posted On2016-09-01