Incidental Mutation 'R5417:Olfr612'
ID427786
Institutional Source Beutler Lab
Gene Symbol Olfr612
Ensembl Gene ENSMUSG00000094119
Gene Nameolfactory receptor 612
SynonymsMOR15-3, GA_x6K02T2PBJ9-6251685-6250741, EG545985
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103537222-103542717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103538763 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 157 (V157E)
Ref Sequence ENSEMBL: ENSMUSP00000149996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104879] [ENSMUST00000214269] [ENSMUST00000215663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104879
AA Change: V157E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100473
Gene: ENSMUSG00000094119
AA Change: V157E

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 37 309 4.7e-11 PFAM
Pfam:7tm_1 43 294 3.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214269
AA Change: V157E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215663
AA Change: V157E

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Olfr612
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Olfr612 APN 7 103538574 missense probably damaging 1.00
IGL01901:Olfr612 APN 7 103538970 missense probably damaging 0.98
R1200:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R1591:Olfr612 UTSW 7 103539067 missense probably benign 0.00
R1858:Olfr612 UTSW 7 103538652 missense probably damaging 1.00
R1975:Olfr612 UTSW 7 103538994 missense probably damaging 1.00
R1994:Olfr612 UTSW 7 103538359 missense possibly damaging 0.57
R3690:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R4635:Olfr612 UTSW 7 103539148 missense probably benign 0.00
R4670:Olfr612 UTSW 7 103539186 missense possibly damaging 0.89
R5267:Olfr612 UTSW 7 103538824 missense probably benign 0.19
R6644:Olfr612 UTSW 7 103539058 missense possibly damaging 0.94
R7253:Olfr612 UTSW 7 103538788 missense probably benign 0.01
R7278:Olfr612 UTSW 7 103538728 missense probably benign 0.02
R7525:Olfr612 UTSW 7 103539131 nonsense probably null
R7553:Olfr612 UTSW 7 103539156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGGGAAGCCATACTCAG -3'
(R):5'- CCACTGCTTGTTTCACACAG -3'

Sequencing Primer
(F):5'- CTGTGGGAAGCCATACTCAGTACTG -3'
(R):5'- ACACAGATGTTCTTCATTCACAC -3'
Posted On2016-09-01