Incidental Mutation 'R5417:Oxr1'
ID427802
Institutional Source Beutler Lab
Gene Symbol Oxr1
Ensembl Gene ENSMUSG00000022307
Gene Nameoxidation resistance 1
SynonymsC7B, 2210416C20Rik, C7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location41447482-41861048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41820371 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 378 (T378A)
Ref Sequence ENSEMBL: ENSMUSP00000155161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022918] [ENSMUST00000090095] [ENSMUST00000090096] [ENSMUST00000110297] [ENSMUST00000170127] [ENSMUST00000179393] [ENSMUST00000229511] [ENSMUST00000229769] [ENSMUST00000230203] [ENSMUST00000230778]
Predicted Effect probably benign
Transcript: ENSMUST00000022918
AA Change: T378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022918
Gene: ENSMUSG00000022307
AA Change: T378A

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 616 778 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090095
AA Change: T378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087553
Gene: ENSMUSG00000022307
AA Change: T378A

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090096
AA Change: T378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087554
Gene: ENSMUSG00000022307
AA Change: T378A

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110297
AA Change: T466A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105926
Gene: ENSMUSG00000022307
AA Change: T466A

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
LysM 99 142 2.48e-9 SMART
low complexity region 201 208 N/A INTRINSIC
low complexity region 628 645 N/A INTRINSIC
TLDc 704 866 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170127
AA Change: T459A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126266
Gene: ENSMUSG00000022307
AA Change: T459A

DomainStartEndE-ValueType
LysM 92 135 2.48e-9 SMART
low complexity region 194 201 N/A INTRINSIC
low complexity region 621 638 N/A INTRINSIC
TLDc 670 832 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179393
AA Change: T378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136923
Gene: ENSMUSG00000022307
AA Change: T378A

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229511
Predicted Effect probably benign
Transcript: ENSMUST00000229769
AA Change: T397A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000230203
AA Change: T466A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230778
AA Change: T378A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive cerebellar neurodegeneration and ataxia, increased apoptosis in the cerebellar granule cell layer, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Oxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Oxr1 APN 15 41820143 missense possibly damaging 0.46
IGL02243:Oxr1 APN 15 41535701 utr 5 prime probably benign
IGL02711:Oxr1 APN 15 41653671 splice site probably benign
IGL02810:Oxr1 APN 15 41813583 missense probably benign 0.26
IGL02850:Oxr1 APN 15 41854933 missense probably damaging 1.00
IGL03028:Oxr1 APN 15 41817163 missense probably damaging 1.00
IGL03126:Oxr1 APN 15 41820249 missense possibly damaging 0.66
PIT4378001:Oxr1 UTSW 15 41801582 missense probably benign 0.01
R0004:Oxr1 UTSW 15 41820540 missense possibly damaging 0.64
R0276:Oxr1 UTSW 15 41820062 missense probably damaging 1.00
R0394:Oxr1 UTSW 15 41817197 missense probably damaging 1.00
R1513:Oxr1 UTSW 15 41797474 missense probably damaging 1.00
R1742:Oxr1 UTSW 15 41850559 missense probably damaging 1.00
R2145:Oxr1 UTSW 15 41819944 missense probably damaging 1.00
R2924:Oxr1 UTSW 15 41825957 missense probably benign 0.01
R3732:Oxr1 UTSW 15 41848701 missense probably damaging 1.00
R4537:Oxr1 UTSW 15 41820519 missense possibly damaging 0.67
R4722:Oxr1 UTSW 15 41813649 missense probably damaging 1.00
R4935:Oxr1 UTSW 15 41813584 missense probably benign 0.00
R6029:Oxr1 UTSW 15 41825901 missense probably damaging 1.00
R6187:Oxr1 UTSW 15 41825919 missense probably damaging 1.00
R6864:Oxr1 UTSW 15 41823387 missense probably damaging 1.00
R6950:Oxr1 UTSW 15 41820555 missense probably benign 0.00
R7225:Oxr1 UTSW 15 41813608 missense not run
R7288:Oxr1 UTSW 15 41813608 missense not run
R7305:Oxr1 UTSW 15 41813608 missense not run
X0025:Oxr1 UTSW 15 41820452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCTTAAGTGGTCTGG -3'
(R):5'- AGACTAACCAGCCTTGCATCTC -3'

Sequencing Primer
(F):5'- TGGAAACAGCCACTAAAGGAG -3'
(R):5'- CCATGTGCGTCTGCTGCTG -3'
Posted On2016-09-01