Incidental Mutation 'R5417:Skiv2l'
ID427811
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Namesuperkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms4930534J06Rik, Ski2w
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34839228-34850210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34846598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 327 (V327I)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173065] [ENSMUST00000173357] [ENSMUST00000173415]
Predicted Effect probably damaging
Transcript: ENSMUST00000046022
AA Change: V327I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: V327I

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097343
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165953
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect probably benign
Transcript: ENSMUST00000173065
SMART Domains Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect probably benign
Transcript: ENSMUST00000173357
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5623:Skiv2l UTSW 17 34847432 missense probably benign 0.00
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6501:Skiv2l UTSW 17 34844436 missense possibly damaging 0.95
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6730:Skiv2l UTSW 17 34845190 nonsense probably null
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTGAACCACTTATCTACAGGG -3'
(R):5'- CCACATATCTTCCAGGCCTG -3'

Sequencing Primer
(F):5'- CTGAACCACTTATCTACAGGGTAAGG -3'
(R):5'- ACATATCTTCCAGGCCTGTCTTG -3'
Posted On2016-09-01