Incidental Mutation 'R5417:Klc4'
ID427812
Institutional Source Beutler Lab
Gene Symbol Klc4
Ensembl Gene ENSMUSG00000003546
Gene Namekinesin light chain 4
SynonymsKnsl8, 1200014P03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46630631-46645144 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46632031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003642] [ENSMUST00000003642] [ENSMUST00000003642] [ENSMUST00000044442]
Predicted Effect probably null
Transcript: ENSMUST00000003642
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000003642
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000003642
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044442
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Klc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Klc4 APN 17 46635435 missense probably damaging 1.00
IGL01929:Klc4 APN 17 46644247 critical splice donor site probably null
IGL02550:Klc4 APN 17 46636910 splice site probably null
IGL03395:Klc4 APN 17 46632863 missense probably damaging 1.00
R0033:Klc4 UTSW 17 46635433 missense probably damaging 1.00
R1653:Klc4 UTSW 17 46631859 missense possibly damaging 0.91
R1681:Klc4 UTSW 17 46636770 missense probably damaging 0.99
R1944:Klc4 UTSW 17 46636627 missense probably damaging 1.00
R4981:Klc4 UTSW 17 46644361 missense probably benign 0.03
R5577:Klc4 UTSW 17 46635429 missense probably damaging 1.00
R5742:Klc4 UTSW 17 46642271 missense probably damaging 1.00
R6224:Klc4 UTSW 17 46640062 missense possibly damaging 0.71
R6245:Klc4 UTSW 17 46636679 missense probably damaging 1.00
R6516:Klc4 UTSW 17 46642255 missense probably damaging 1.00
R6890:Klc4 UTSW 17 46631843 missense probably benign 0.01
R6925:Klc4 UTSW 17 46636229 missense possibly damaging 0.69
R7466:Klc4 UTSW 17 46639910 missense probably benign 0.22
X0025:Klc4 UTSW 17 46640675 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTTTAAGTAGTTCAGCGAGGC -3'
(R):5'- CATTGCTTTCAATCACTGGGC -3'

Sequencing Primer
(F):5'- CCGCCCGCTTCATGCTG -3'
(R):5'- ATTGCTTTCAATCACTGGGCTTCAG -3'
Posted On2016-09-01