Incidental Mutation 'R5417:Pcdhb12'
ID427814
Institutional Source Beutler Lab
Gene Symbol Pcdhb12
Ensembl Gene ENSMUSG00000043458
Gene Nameprotocadherin beta 12
SynonymsPcdh3, PcdhbL, Pcdhb5F
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37435621-37438654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37436034 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 78 (F78L)
Ref Sequence ENSEMBL: ENSMUSP00000050357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055495] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055495
AA Change: F78L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458
AA Change: F78L

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193629
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Pcdhb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pcdhb12 APN 18 37436982 missense probably benign 0.44
IGL01309:Pcdhb12 APN 18 37436154 missense probably damaging 1.00
IGL01834:Pcdhb12 APN 18 37437639 missense probably damaging 1.00
IGL01893:Pcdhb12 APN 18 37437210 missense probably benign 0.01
IGL02617:Pcdhb12 APN 18 37437046 missense probably benign 0.43
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0309:Pcdhb12 UTSW 18 37436121 missense probably benign
R0392:Pcdhb12 UTSW 18 37436958 missense possibly damaging 0.60
R0494:Pcdhb12 UTSW 18 37438095 missense probably benign
R0531:Pcdhb12 UTSW 18 37437318 missense probably damaging 1.00
R0571:Pcdhb12 UTSW 18 37437208 missense probably damaging 1.00
R0737:Pcdhb12 UTSW 18 37437709 missense probably damaging 1.00
R0882:Pcdhb12 UTSW 18 37437322 missense probably damaging 1.00
R1253:Pcdhb12 UTSW 18 37435821 missense possibly damaging 0.65
R1300:Pcdhb12 UTSW 18 37437397 missense possibly damaging 0.45
R1334:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1424:Pcdhb12 UTSW 18 37438079 missense probably benign
R1513:Pcdhb12 UTSW 18 37437058 missense probably damaging 1.00
R1654:Pcdhb12 UTSW 18 37436701 missense probably damaging 1.00
R1717:Pcdhb12 UTSW 18 37436788 missense probably damaging 1.00
R1753:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1774:Pcdhb12 UTSW 18 37436442 missense possibly damaging 0.52
R1893:Pcdhb12 UTSW 18 37437083 missense probably benign 0.24
R1901:Pcdhb12 UTSW 18 37437630 missense possibly damaging 0.67
R2114:Pcdhb12 UTSW 18 37436212 missense probably damaging 1.00
R2264:Pcdhb12 UTSW 18 37436805 missense probably damaging 0.99
R2915:Pcdhb12 UTSW 18 37437640 missense probably damaging 1.00
R3689:Pcdhb12 UTSW 18 37436074 missense probably benign 0.01
R3918:Pcdhb12 UTSW 18 37437048 missense probably benign
R4621:Pcdhb12 UTSW 18 37437160 missense probably benign
R4679:Pcdhb12 UTSW 18 37436949 missense probably damaging 1.00
R4709:Pcdhb12 UTSW 18 37437495 missense probably benign 0.08
R4904:Pcdhb12 UTSW 18 37437856 missense possibly damaging 0.80
R4953:Pcdhb12 UTSW 18 37436156 missense probably damaging 1.00
R5091:Pcdhb12 UTSW 18 37435854 nonsense probably null
R5130:Pcdhb12 UTSW 18 37435824 missense probably benign
R5204:Pcdhb12 UTSW 18 37436089 missense probably damaging 0.99
R5361:Pcdhb12 UTSW 18 37437046 missense probably damaging 1.00
R5979:Pcdhb12 UTSW 18 37437991 missense possibly damaging 0.94
R6117:Pcdhb12 UTSW 18 37435642 intron probably benign
R6258:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6260:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6270:Pcdhb12 UTSW 18 37436785 missense possibly damaging 0.68
R6623:Pcdhb12 UTSW 18 37437658 missense possibly damaging 0.54
R7288:Pcdhb12 UTSW 18 37436015 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTCTGACTCTGAGGCAATTAG -3'
(R):5'- TCATGAGCTGCCTTCAGAGG -3'

Sequencing Primer
(F):5'- GAGGCAATTAGATATTCCATGCCAG -3'
(R):5'- TTCAGAGGAAACACAGTCCCTGG -3'
Posted On2016-09-01