Incidental Mutation 'R5418:Pkp4'
ID427828
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
MMRRC Submission 042986-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5418 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59310162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 404 (V404A)
Ref Sequence ENSEMBL: ENSMUSP00000122152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]
Predicted Effect probably benign
Transcript: ENSMUST00000037903
AA Change: V404A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: V404A

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102754
AA Change: V404A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: V404A

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112577
AA Change: V63A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991
AA Change: V63A

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123908
AA Change: V404A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: V404A

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124725
Predicted Effect probably benign
Transcript: ENSMUST00000168631
AA Change: V404A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: V404A

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Predicted Effect probably benign
Transcript: ENSMUST00000184705
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Crlf2 A G 5: 109,557,033 V104A probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Glrx2 C A 1: 143,739,708 S16R possibly damaging Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Klra6 T A 6: 130,013,430 L239F probably damaging Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mapk14 T C 17: 28,741,843 V196A possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Piezo1 A G 8: 122,486,780 L1793P probably damaging Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59334932 critical splice donor site probably null
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59305067 missense probably benign 0.01
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59308137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAGTCCTTTTCATACCAGGCC -3'
(R):5'- AAAATCTCTTTCCTGTTGGGCC -3'

Sequencing Primer
(F):5'- AGGCCTTCCTTCTGTAAAACTTGAG -3'
(R):5'- CCTGTTGGGCCAAGGAGATG -3'
Posted On2016-09-01