Incidental Mutation 'R5418:Piezo1'
ID427854
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission 042986-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5418 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122486780 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1793 (L1793P)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000151855] [ENSMUST00000156333]
Predicted Effect probably damaging
Transcript: ENSMUST00000067252
AA Change: L1792P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: L1792P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect probably benign
Transcript: ENSMUST00000148497
AA Change: S1056P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444
AA Change: S1056P

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect probably damaging
Transcript: ENSMUST00000156333
AA Change: L1793P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: L1793P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Crlf2 A G 5: 109,557,033 V104A probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Glrx2 C A 1: 143,739,708 S16R possibly damaging Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Klra6 T A 6: 130,013,430 L239F probably damaging Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mapk14 T C 17: 28,741,843 V196A possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Pkp4 T C 2: 59,310,162 V404A probably benign Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 unclassified probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 unclassified probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense not run
Predicted Primers PCR Primer
(F):5'- GTCCCAGAGGCCATAACACTATG -3'
(R):5'- TCTTCACTGAGGTGGGTAGC -3'

Sequencing Primer
(F):5'- CATAACACTATGGAGGATACGGGTTG -3'
(R):5'- TGAGTGCCCTGTCCTGCAG -3'
Posted On2016-09-01