Incidental Mutation 'R5418:Mapk14'
ID427892
Institutional Source Beutler Lab
Gene Symbol Mapk14
Ensembl Gene ENSMUSG00000053436
Gene Namemitogen-activated protein kinase 14
Synonymsp38MAPK, CSBP2, p38 alpha, p38a, Mxi2, p38 MAP kinase alpha, p38 MAP Kinase, p38alpha, p38-alpha, p38, Csbp1, Crk1, p38 MAPK
MMRRC Submission 042986-MU
Accession Numbers

Genbank: NM_011951; MGI: 1346865

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5418 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28691342-28748404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28741843 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000110402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004990] [ENSMUST00000062694] [ENSMUST00000114752] [ENSMUST00000114754] [ENSMUST00000114758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004990
AA Change: V273A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004990
Gene: ENSMUSG00000053436
AA Change: V273A

DomainStartEndE-ValueType
S_TKc 24 308 3.46e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000062694
AA Change: V273A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061958
Gene: ENSMUSG00000053436
AA Change: V273A

DomainStartEndE-ValueType
S_TKc 24 308 7.42e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114752
AA Change: V196A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110400
Gene: ENSMUSG00000053436
AA Change: V196A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114754
AA Change: V196A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110402
Gene: ENSMUSG00000053436
AA Change: V196A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114758
SMART Domains Protein: ENSMUSP00000110406
Gene: ENSMUSG00000053436

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 242 3.8e-32 PFAM
Pfam:Pkinase 24 257 9.4e-65 PFAM
Pfam:Kdo 40 181 3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151613
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for various null mutations are embryonic to perinatal lethal showing multiple organ system defects. Mice homozygous for a knock-out mutation exhibit abnormal myoblast differentiation and delayed myofiber growth and maturation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, knock-out(4) Targeted, other(9) Gene trapped(7)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Crlf2 A G 5: 109,557,033 V104A probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Glrx2 C A 1: 143,739,708 S16R possibly damaging Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Klra6 T A 6: 130,013,430 L239F probably damaging Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Piezo1 A G 8: 122,486,780 L1793P probably damaging Het
Pkp4 T C 2: 59,310,162 V404A probably benign Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Mapk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Mapk14 APN 17 28725846 critical splice donor site probably null
IGL03013:Mapk14 APN 17 28728349 splice site probably benign
Wanzhou UTSW 17 28724824 missense probably damaging 1.00
D4043:Mapk14 UTSW 17 28745150 missense probably damaging 1.00
R0418:Mapk14 UTSW 17 28691789 missense probably benign
R4513:Mapk14 UTSW 17 28724824 missense probably damaging 1.00
R4514:Mapk14 UTSW 17 28724824 missense probably damaging 1.00
R4674:Mapk14 UTSW 17 28745022 unclassified probably null
R4981:Mapk14 UTSW 17 28741791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAATTGAGCATCCCAG -3'
(R):5'- TGTGACAATACAGACAGACAGTAAC -3'

Sequencing Primer
(F):5'- ATTGAGCATCCCAGACAGTGGTC -3'
(R):5'- TAAGGGCTGCTCTTCCAAAG -3'
Posted On2016-09-01