Incidental Mutation 'R5420:BC005561'
ID427979
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission 042988-MU
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104518359 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 249 (I249N)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: I249N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: I249N

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Meta Mutation Damage Score 0.3404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGCTGATTGTTGAATTAGGGCAAG -3'
(R):5'- CGGAAGGCAATACAACCATTG -3'

Sequencing Primer
(F):5'- GGGCAAGATTTATCTGGAAATATCAC -3'
(R):5'- ACAATTTGCTTAGCTTCCACAATTTC -3'
Posted On2016-09-01