Incidental Mutation 'R5431:Fam178b'
ID428027
Institutional Source Beutler Lab
Gene Symbol Fam178b
Ensembl Gene ENSMUSG00000046337
Gene Namefamily with sequence similarity 178, member B
Synonyms1700024G10Rik, LOC381337
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36562692-36683183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36632485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 185 (E185G)
Ref Sequence ENSEMBL: ENSMUSP00000124023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114981] [ENSMUST00000170295]
Predicted Effect probably damaging
Transcript: ENSMUST00000114981
AA Change: E185G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124023
Gene: ENSMUSG00000046337
AA Change: E185G

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 89 371 3.4e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170295
AA Change: E185G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132846
Gene: ENSMUSG00000046337
AA Change: E185G

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 86 385 1e-130 PFAM
low complexity region 395 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Fam178b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Fam178b APN 1 36564403 missense possibly damaging 0.90
IGL01128:Fam178b APN 1 36644354 missense probably damaging 1.00
IGL01859:Fam178b APN 1 36659365 missense probably damaging 1.00
R0398:Fam178b UTSW 1 36632406 splice site probably benign
R1116:Fam178b UTSW 1 36578588 nonsense probably null
R1613:Fam178b UTSW 1 36600192 missense probably benign 0.01
R1623:Fam178b UTSW 1 36644324 missense probably damaging 1.00
R2276:Fam178b UTSW 1 36632458 missense probably damaging 1.00
R3706:Fam178b UTSW 1 36608448 missense probably damaging 1.00
R4535:Fam178b UTSW 1 36600525 missense probably benign 0.43
R4784:Fam178b UTSW 1 36632415 splice site probably null
R5372:Fam178b UTSW 1 36564848 missense possibly damaging 0.95
R6808:Fam178b UTSW 1 36600135 missense probably damaging 1.00
R7117:Fam178b UTSW 1 36600467 missense probably benign 0.04
R7308:Fam178b UTSW 1 36659407 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAAGATGTGTGGCCTGATG -3'
(R):5'- ACTTGGAAGCATTAAGATGAGTCC -3'

Sequencing Primer
(F):5'- CCTGATGTCTGTAGCACAGG -3'
(R):5'- GCTTGGCTAAAAGAGATCCTGTC -3'
Posted On2016-09-01